IC Pest and Disease
Not cannabis specific
A Low transmissibility of hop latent viroid through a generative phase of Humulus lupulus L.
J.Matousek, J. Patzak
Biologica Plantarium 43 (1): 145-148 (2000)
https://bp.ueb.cas.cz/pdfs/bpl/2000/01/33.pdf
A significant reduction of hop latent viroid (HLVd) content during the generative phase of hop was detected using reverse transcriptase-polymerase chain reaction (RT PRC) and molecular hybridisation methods. A low transmissibility of HLVd through seed may be a feature valuable for the selection and maintenance of viroid-free hybrid hops.
A review of Cannabis sativa-based insecticides, Miticides, and repellents
John McPartland, Zahra Sheikh
Journal of Entomology and Zoology Studies 2018; 6(6): 1288-1299
https://www.researchgate.net/publica...and_repellents
Plant-based pesticides are gaining attention as safe, effective, eco-friendly alternatives to synthetic pesticides. We conducted a literature search regarding the use of hemp (Cannabis sativa) as a plant-based insecticide, miticide, or repellent. The search yielded 88 publications, which we grouped into five types of applications: companion planting (17 articles), the use of harvested plant material without any extraction (25 publications), aqueous extracts (20 publications), essential oil extracts (EOs, nine publications), and solvent extracts (17 publications). Few studies chemically analyzed the contents of their extracts, and most studies lacked control comparisons. EO studies were the most rigorous, and yielded the best results. Results with solvent extracts showed moderate efficacy, but little better than aqueous extracts, which lacked tetrahydrocannabinol (THC). Collectively, the studies suggest that EOs (terpenoids) are the primary Cannabis constituents responsible for arthropod deterrence. THC exerts nominal deterrence, but is toxic to insects. Mechanisms of action are discussed
A Study of Different Disease Detection and Classification Techniques using Deep Learning for Cannabis Plant
Kanaad Pathak, Arti Arya, Prakash Hatti, Vidyadhar Handragal and Kristopher Lee
International Journal of Computing and Digital Systems Int. J. Com. Dig. Sys. 10, No.1 (Jan-2021)
DOI: 10.12785/ijcds/100106
https://journal.uob.edu.bh/bitstream...=4&isAllowed=y
In this paper, different models for disease detection and classification are studied for cannabis plants. Cannabis plants are used for medical and recreational purposes with its recent legalization in some places. Cannabis farmers face problems in cultivation of the crop since it’s susceptible to multiple disorders. With early detection of the disease in the crop it is possible to prevent large waste of yield in the crop. A real dataset is considered for disease detection and classification purposes which is a combination of text and image data and that has been collected over a period of one and a half years (Feb 2018-August 2019). The models used in this study are Fast Region Convolutional Neural Network(F-RCNN), MobileNet Single Shot Multibox Detector(MobileNet-SSD), You Only Look Once(YOLO) and Residual Network-50 Layers (ResNet50). It is found that the MobileNet-SSD provided the best accuracy amongst all the object detection models that are studied and has a lesser training time as well. ResNet 50 is used for identifying the number of images required for a good fit without having to label first and then studied for the object detection models.
Acaricidal properties of hemp (Cannabis sativa L.) essential oil against Dermanyssus gallinae and Hyalomma dromedarii
Mohaddeseh Abouhosseini Tabaria, Aref Khodashenasb, Maryam Jafarib, Riccardo Petrellic, Loredana Cappellaccic, Massimo Nabissic, Filippo Maggic, Roman Pavelad, Mohammad Reza Youssef
Industrial Crops and Products Volume 147, May 2020,
DOI: 10.1016/j.indcrop.2020.112238
The use of conventional pesticides in pest management is facing issues such as developing resistance in pests, environmental pollution and impact on human health, together with regulatory hurdles for approval and marketing of new eco-friendly pesticides to comply with the global trend for residue-free foodstuff. In this framework, botanical pesticides represent valuable alternative products to be exploited. Hemp (Cannabis sativa L.) is an eco-friendly, multipurpose crop that is known for its resistance against insects and parasites. This property is assured by the production of bioactive secondary metabolites such as terpenes and cannabinoids. Notably, the hemp essential oil (EO) contains several terpenoid compounds endowed with pesticide properties. On this basis, in the present work we assayed the toxicity of hemp EO on two ectoparasites of veterinary importance, i.e. Dermanyssus gallinae De Geer and Hyalomma dromedarii Koch. In order to identify the EO chemical constituents responsible for the toxicity on the two ectoparasites, the main monoterpenes and sesquiterpenes of hemp EO, namely ?-pinene, myrcene, (E)-caryophyllene and ?-humulene were tested as well. Mite contact toxicity assays were carried out at the concentrations of 5, 10, 20, 50, 100 and 200 ?g/cm3 . Tick larvicidal and ovicidal assays were done testing 0.5, 1, 2, 5, 10, 20, and 50 ?g/mL of the hemp EO and its main components. Results from mite contact toxicity showed that hemp EO was toxic to D. gallinae with LC50 values of 47.1 ?g/mL. Larvicidal and ovicidal assays revealed the promising activity of the EO against tick larvae and eggs. Among all the tested compounds, (E)–caryophyllene and ?-humulene were the most toxic for both ticks and mites, showing LC50 values lower than the whole EO. Myrcene was moderately toxic, with LC50 values higher than the whole EO, whereas ?-pinene showed weak acaricidal activity. Taken together our results remarked the potential of hemp EO as a potential botanical acaricide in pest management programs and food production. The industrial scalability is assured by the great availability of land for the cultivation of hemp and its low cost of production.
NOT CANNABIS SPECIFIC
Advanced methods of plant disease detection. A review
Federico Martinelli, Riccardo Scalenghe, Salvatore Davino, Stefano Panno, Giuseppe Scuderi, Paolo Ruisi, Paolo Villa, Daniela Stroppiana, Mirco Boschetti, Luiz R. Goulart, et al.
Agronomy for Sustainable Development, Springer Verlag/EDP Sciences/INRA, 2015, 35 (1), pp.1-25.
Doi: 10.1007/s13593-014-0246-1
Plant diseases are responsible for major economic losses in the agricultural industry worldwide. Monitoring plant health and detecting pathogen early are essential to reduce disease spread and facilitate effective management practices. DNA-based and serological methods now provide essential tools for accurate plant disease diagnosis, in addition to the traditional visual scouting for symptoms. Although DNA-based and serological methods have revolutionized plant disease detection, they are not very reliable at asymptomatic stage, especially in case of pathogen with syste
mic diffusion. They need at least 1–2 days for sample harvest, processing, and analysis. Here, we describe modern methods based on nucleic acid and protein analysis. Then, we review innovative approaches currently under development. Our main findings are the following: (1) novel sensors based on the analysis of host responses, e.g., differential mobility spectrometer and lateral flow devices, deliver instantaneous results and can effectively detect early infections directly in the field; (2) biosensors based on phage display and biophotonics can also detect instantaneously infections although they can be integrated with other systems; and (3) remote sensing techniques coupled with spectroscopy-based methods allow high spatialization of results, these techniques may be very useful as a rapid preliminary identification of primary infections. We explain how these tools will help plant disease management and complement serological and DNA-based methods. While serological and PCR-based methods are the most available and effective to confirm disease diagnosis, volatile and biophotonic sensors provide instantaneous results and may be used to identify infections at asymptomatic stages. Remote sensing technologies will be extremely helpful to greatly spatialize diagnostic results. These innovative techniques represent unprecedented tools to render agriculture more sustainable and saffe, avoiding expensive use of pesticides in crop protection.
NOT CANNABIS SPECIFIC
Adventive aphids (Hemiptera: Aphididae) of America North of Mexico
R.G. Foottit, Susan Halbert, Gary L. Miller, L.M. Russell
November 2005 Proceedings- Entomological Society of Washington 108(3) SourceOAI
https://www.researchgate.net/publica...orth_of_Mexico
We provide a compilation of 262 species of aphids that are considered as adventive to North America north of Mexico. Included for each species, where applicable, is reference to: the location and date of introduction of the first North American record; pest status in North America; principal economic hosts; and biogeographical origin. Information is also provided for species whose presence in North America is considered erroneous or questionable and for those species that are considered Holarctic or Beringian.
Agdia ImmunoStrips Testing made easy
Virus test strips
https://www.atzlabs.com/pdf/ImmunoSt...tech_India.pdf
Grow with Confidence Agdia is no stranger to understanding how confidence can impact your business. Customers must be confident they are buying quality products; otherwise, they will look for alternatives. In order to ensure customers receive a quality product, the supplier must be confident that they have all the tools necessary to produce it. In the case of crop production, plant disease can have negative impacts on both a grower’s confidence and their reputation. Since 1981, Agdia has been dedicated to helping growers manage plant disease through early and routine diagnosis of plant pathogens. Today, we are the leading provider of plant disease diagnostics in the industry with a comprehensive line of testing products that are used world-wide. We realize you have options when it comes to diagnostic providers. If you want to work with a testing provider that was built and has grown on the principle of confidence, test with Agdia
An Overview of Hemp Diseases
Journal of the Institute of Science and Technology June 2020 (in Turkish)
Mehmet Ali Sevik
DOI: 10.21597/jist.670642
https://www.researchgate.net/publica..._Hemp_Diseases
Industrial hemp (Cannabis sativa var. vulgaris L.), a variant of the C. sativa plant, is an important industrial crop. Industrial hemp is one of the oldest crops plants know to humans. Hemp is very sensitive to environmental conditions, diseases, and pests. Environmentally stressed plants become predisposed to diseases. Diseases of Cannabis are caused by biotic (bacteria, fungi, viruses, viroids, phytoplasmas) or abiotic (nutrient deficiencies) sources. Cannabis species suffer over 100 diseases. Disease prevalence is also varied by geography and climate. Serious fungal diseases on hemp include gray mold, hemp canker, damping off, assorted leaf spots, blights, root rots. Important bacterial diseases include bacterial blight, wilt, crown gall, striatura ulcerosa, and xanthomonas leaf spot. In Cannabis cultivars were reported including the diseases caused by Hemp streak virus (HSV), Hemp mosaic virus (HMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), and Arabis mosaic virus (ArMV). Important diseases affecting the hemp crop along with their symptoms, means of movement and dispersal, and management are briefly summarized in the paper.
An overview of pathogen and insect threats to fibre and oilseed hemp (Cannabis sativa L.) and methods for their biocontrol
Malgorzata Jedryczka, Fatema Bakro, Katarzyna Wielgusz, Marek Bunalski
Integrated Control in Oilseed Crops IOBC-WPRS Bulletin Vol. 136, 2018 pp. 9-20 September 2018
https://www.researchgate.net/publica...eir_biocontrol
Hemp (Cannabis sativa L.) is a treasure trove plant for both sustainable agriculture and industrial usage. It has multi-application properties due to the production of fibre and high quality oil, biomass as a safe source of energy, and numerous compounds for the pharmaceutical sectors, including mainly cannabinoids (THC and CBD) which have a wide range of psychotropic activities. Hemp, like other plants, suffers from a wide range of pests and pathogens. They cause plant damage, huge annual loss of biomass and seed yield as well as the reduction of the quality of the products. With increased demand for hemp products, its production area is anticipated to expand greatly; previously developed tolerance of environmental pressures or defense mechanisms against biotic threats may not meet the demands of new environments and the additional pathogens that will be encountered. In this review we focus on the most common fungal, oomycetes, viral and pest diseases attacking hemp both worldwide and in Poland. We also highlight the methods of biological control that make possible the maintenance healthy plants as well as the high quality of hemp products.
Not Cannabis specific
Analysis of Cryptic, Systemic Botrytis Infections in Symptomless Hosts
Michael W. Shaw, Christy J. Emmanuel, Deni Emilda, Razak B. Terhem, Aminath Shafia, Dimitra Tsamaidi, Mark Emblow and Jan A. L. van Kan
Frontiers in Plant Science, 7 2016
doi: 10.3389/fpls.2016.00625
Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. Botrytis cinerea and Botrytis pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents) when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles.
Apparent Increase in Biomass and Seed Productivity in Hemp (Cannabis sativa) Resulting from Branch Proliferation Caused by the European Corn Borer (Ostrinia nubilalis)
Ernest Small, David Marcus, Gail Butler, A. R. McElroy
May 2007 Journal of Industrial Hemp 12(1):15-26
DOI: 10.1300/J237v12n01_03
The European corn borer (Ostrinia nubilalis Hübner), or
ECB, is a major pest of hemp (Cannabis sativa L.). During the course of a study of hemp germplasm and cultivar accessions, the ECB attacked the vertical stem leader of hundreds of plants. At the site of invasion the main stem was typically destroyed, and the plant became strongly branched. Although the damaged plants were an average 9% shorter, mean shoot weight was 20% heavier. Seed productivity was also greater, based on a visual scale. The practical significance of such an “overcompensation” response to insect damage, with damaged plants growing more robustly and productively than their undamaged counterparts, is controversial. Certainly, some aspects of productivity, such as fibre quality, are detrimentally affected by the ECB. The insect showed a preference for larger plants, but was indifferent to the level of tetrahydrocannabinol, the chief intoxicant of C. sativa.
Arthropod pests of hemp (Cannabis sativa L.)
Peter A. Edde
In book: Field Crop Arthropod Pests of Economic Importance January 2022 pg 915-952
DOI: 10.1016/B978-0-12-818621-3.00012-4
https://www.researchgate.net/publica...a_L/references
Hemp is a member of the Cannabaceae family in the rose order (Rosales). Cannabaceae currently contains approximately 11 genera and 170 species of plants. Cannabis and hops ( Humulus ) are the most economically important members of the family. The term “hemp,” has been used broadly to describe many different plant species from several genera and families producing bast fibers, all similar in appearance and quality. Among these are sunn hemp, produced from Crotalaria juncea L. (Fabaceae); sisal hemp, obtained from leaves of Agave sisalana Perrine (Asparagaceae); Manila hemp (abaca), derived from the leaf stalks of Musa textilis Née (Musaceae); Mauritius hemp, obtained from green aloe, Furcraea foetida (L.) Haw (Asparagaceae); and India hemp, produced from plants in the genus Corchorus (Malvaceae). The true hemp plant, Cannabis sativa L., is cultivated chiefly for its fiber, but the seed is used for medicinal and narcotic purposes.
There are three distinct types of cultivated hemp, each further subdivided into varieties. One type of hemp is grown for fiber. Depending on variety, hemp grown for fiber are high in cellulose with stalks up to 4.9 m high. A second type is cultivated for fruit (or seed), which is utilized as a source of oil and food due to its high digestible protein and essential fatty acid content. A third type of hemp, Cannabis sativa, var. indica is high in alkaloids called cannabinoids. The cannabinoids are derived from the dried inflorescences and upper leaves of the carpellate plant. The plant has medicinal and narcotic properties ( Small & Marcus, 2002 ). The common names hemp and marijuana are associated with all three forms
Bacterial leaf spot of hemp caused by Xanthomonas campestris pv. cannabis in Japan.
Netsu, O., Kijima, T., & Takikawa, Y.
Journal of General Plant Pathology, 80(2), 164–168. (2013).
doi:10.1007/s10327-013-0497-8
Bacterial leaf spot disease of hemp was observed in Tochigi Prefecture, Japan in 1982 and characterized by necrotic lesions ca. 1–2 mm diameter on leaves with a yellow halo 2–3 mm wide. In this report, we describe the pathological, physiological and genetic properties of the causal bacterium. Our results indicated that this bacterium is identical with Xanthomonas campestris pv. cannabis reported in Romania.
... cannabis is still obscure. When Vauterin et al. (1995) proposed a new species of Xanthomonas as a result of DNA–DNA hybridization studies, pv. cannabis was left unclassified, and the combination of the name X. campestris pv. can- nabis remained (Bull et al. 2010a). .
Bacteriological and cannabinoids analysis
Dr. José Carlos Bouso
https://www.fundacion-canna.es/en/ba...noids-analysis
The main sanitary problem the users of ilegal drugs in general, and Cannabis users in particular, face, is that there are several unknown factors about the product they are consuming, such as: 1. the manufacturing and/or cultivation processes; 2. the purity, agglutinative and other chemical and/or biologic products present; 3. the effects of such products over heath; and 4. how it has been handled, preserved and sold.
Beet Curly Top Virus In Cannabis
YouTube
Most Curtoviruses are one of three Curly Top Virus species
(BCTV) Beet Curly Top Virus
(SpSCTV) Spinach Severe Surley Top Virus
(HrCTV) Horseradish Curly Top Virus
Curtovirus sequences with>77% genome-wide pairwise identity would be classified as belonging to the same species, those sharing >94% identity would be classified as belonging to the strain.
Beneficial Insects for Biological Pest Control in Greenhouse Cannabis Production
Gerasimos Grammenos, Varvara Kouneli, Antonios Kouneli, D Bilalis
Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Horticulture 78(2):85-93 Nov 2021
https://www.researchgate.net/publica...bis_Production (check http)
DOI: 10.15835/buasvmcn-hort:2021.0037
A greenhouse cannabis cultivation took place in Agriculture university of Athens in order to quantify the efficiency of beneficial insects as a main method of pest management. Cannabis plants grown in two greenhouses and beneficial insects were released only in one greenhouse as a means to investigate the efficacy against pests by the comparison with the control greenhouse. Measurements included the visual estimation of infestation, the recording of pest species and populations, and the comparison of infestations and yields amongst greenhouses. Our results indicate that beneficial insects could control pest populations up to 100%. Even though the environmental conditions were not optimal and consecutive pest infestations were observed throughout the duration of our study, the beneficial insects successfully managed the pest populations. In conclusion, biological control with beneficial insects is a very effective method for pest management in greenhouse cannabis production
Bibenzyl synthesis in Cannabis sativa L.
Kelly F. Boddington,Eric Soubeyrand,Kristen Van Gelder,José A. Casaretto,Colby Perrin,Taylor J.B. Forrester,Cameron Parry,M. Sameer Al-Abdul-Wahid,Nicholas G. Jentsch,Jakob Magolan,Gale G. Bozzo,Matthew S. Kimber,Steven J. Rothstein,Tariq A. Akhtar
The Plant Journal Nov 2021
DOI: 10.1111/tpj.15588
https://onlinelibrary.wiley.com/doi/10.1111/tpj.15588
This study focuses on the biosynthesis of a suite of specialized metabolites fromCannabis that are known as the ‘bibenzyls’. In planta, bibenzyls accumulate in response to fungal infection and various other biotic stressors; however, it is their widely recognized anti-inflammatory properties in various animal cell models that have garnered recent therapeutic interest. We propose that these compounds are synthesized via a branch point from the core phenylpropanoid pathway in Cannabis, in a three-step sequence. First, various hydroxycinnamic acids are esterified to acyl-coenzyme A (CoA) by a member of the 4-coumarate-CoA ligase family (Cs4CL4). Next, these CoA esters are reduced by two double-bond reductases (CsDBR2 and CsDBR3) that form their corresponding dihydro-CoA derivatives from preferred substrates. Finally, the bibenzyl backbone is completed by a polyketide synthase that specifically condenses malonyl-CoA with these dihydro-hydroxycinnamoyl-CoA derivatives to form two bibenzyl scaffolds: dihydropiceatannol and dihydroresveratrol. Structural determination of this ‘bibenzyl synthase’ enzyme (CsBBS2) indicates that a narrowing of the hydrophobic pocket surrounding the active site evolved to sterically favor the non-canonical and more flexible dihydro-hydroxycinnamoyl-CoA substrates in comparison with their oxidized relatives. Accordingly, three point mutations that were introduced into CsBBS2 proved sufficient to restore some enzymatic activity with an oxidized substrate, in vitro. Together, the identification of this set of Cannabis enzymes provides a valuable contribution to the growing ‘parts prospecting’ inventory that supports the rational metabolic engineering of natural product therapeutics.
Biocontrol Activity of Bacillus spp. and Pseudomonasspp. Against Botrytis cinerea and Other Cannabis Fungal Pathogens
Carole Balthazar, Amy Novinscak, Gabrielle Cantin, David L. Joly, Martin Filion.
Pathology 2021 July 2021
Doi: 10.1094/PHYTO-03-21-0128-R
Gray mold caused by Botrytis cinerea is one of the most widespread and damaging diseases in cannabis crops worldwide. With challenging restrictions on pesticide use and few effective control measures, biocontrol agents are needed to manage this disease. The aim of this study was to identify and characterize bacterial biocontrol agents with wide-spectrum activity against B. cinerea and other major cannabis fungal pathogens. Twelve Bacillus and Pseudomonas strains were first screened with in vitro confrontational assays against ten culturable cannabis pathogens, namely B. cinerea,Sclerotinia sclerotiorum, Fusarium culmorum, F. sporotrichoides, F. oxysporum, Nigrospora sphaerica, N. oryzae, Alternaria alternata, Phoma sp. and Cercospora sp. Six strains displaying the highest inhibitory activity, namely B. velezensis LBUM279, FZB42, LBUM1082, B. subtilis LBUM979, P. synxantha LBUM223, and P. protegens Pf-5, were further assessed in planta where all, except LBUM223, significantly controlled gray mold development on cannabis leaves. Notably, LBUM279 and FZB42 reduced disease severity by at least half compared to water-treated plants and prevented lesion development and/or sporulation up to 9 days following pathogen inoculation. Genomes of LBUM279, LBUM1082 and LBUM979 were sequenced de novo and taxonomic affiliations were determined to ensure non-relatedness with pathogenic strains. Moreover, the genomes were exempt of detrimental genes encoding major toxins and virulence factors that could otherwise pose a biosafety risk when used on crops. Eighteen gene clusters of potential biocontrol interest were also identified. To our knowledge, this is the first reported attempt to control cannabis fungal diseases in planta by direct antagonism with beneficial bacteria.
Find PDF
Biocontrol agents and their influence on the cannabis testing space
Kevin McKernan, Kristofer Marsh, Steve Cottrell, Sherman Hom
https://osf.io/cn9y4/download https://osf.io/preprints/cn9y4/
Biocontrol agents are a promising and mature agricultural technology that offer a more environmentally friendly solution to controlling pathogenic microbial risks found on agricultural products than the conventional use of chemical pesticides[1]. Often, the application of nonpathogenic or atoxigenic microbial strains can help to outcompete pathogenic microbes in a given niche[2,3]. The genomes of these biocontrol organisms are often modified to eliminate the production of the toxin[4]. This genome driven approach can reduce or even eliminate the use of pesticides or fungicides[3]. Agricultural markets that utilize extraction techniques to concentrate particular resins or nutrients are often drawn to biocontrol approaches as some pesticides and fungicides are known to become enriched during extraction process while the biocontrol agents are often eliminated[5,6]. Nevertheless, some states have microbial testing regulations that inadvertently ban the use of biocontrol agents through the use of non-specific Total Yeast and Mold (TYM) or Total Aerobic Count (TAC) testing. These tests do not discriminate between commonly used biocontrol agents (like bacillus amyloliquefaciens) and pathogenic risks. Bacillus amyloliquefaciens has even been shown to liquify some petri dish plates, further elevating the plate counts[7]. Many states have retired these tests citing the lack of clinical utility and their arbitrary action limits and actionability. This has led some states where cannabis is regulated to implement species specific testing for Aspergillus, E.coli and Salmonella (Figure 1).
BIOLOGICAL CONTROL ORGANISMS FOR INSECTS AND MITES
Whitney Cranshaw, Austin Broberg, and Wendlin Burns
https://webdoc.agsci.colostate.edu/h...iers%20NEW.pdf
A wide variety of beneficial organisms are offered for sale by several suppliers to assist in management of insects and mites. The following is a listing of most of the US suppliers and it is organized into three sections. First is a brief description of organisms with potential applications followed by reference to sources where they may be purchased. This is followed by a brief summary listing of pest groups and the associated potential biological controls. At the end is a listing of addresses of many suppliers/producers
Biotic stress caused by Tetranychus urticae mites elevates the quantity of secondary metabolites cannabinoids and terpenes in Cannabis sativa L
Elizabeth Kostanda, Soliman Khatib
Industrial Crops and Products ( IF 5.645 ) Pub Date : 2021-12-16 ,
DOI: 10.1016/j.indcrop.2021.114331
Secondary metabolites are known to play a role in the plant's defense system, which can be triggered by biotic or abiotic stress. Cannabis (Cannabis sativa L.) plants and mainly their female flowers, have a variety of bioactive metabolites, predominantly cannabinoids and terpenes, which are synthesized and secreted by the trichomes. Many studies have examined their chemistry and bioactive effects; however, there is insufficient information on the effect of biotic stress on the presence of secondary metabolites in cannabis. The present study examined the effect of a well-known cannabis pest,Tetranychus urticae, on the occurrence and concentration of cannabinoids and terpenes in cannabis leaves and flowers. Six cannabis plants were infested with T. urticae mites (treatment group), and six plants were used as the control group. Cannabinoids and terpenes were analyzed and quantified by liquid chromatograph mass spectrometer and gas chromatograph mass spectrometer, respectively. The contents of several cannabinoids and terpenes increased significantly in the leaves of the treatment group of plants in their late vegetative phase as the mite population increased, compared with the control group. Significantly increased content of almost all terpenes, and the cannabinoids; Δ9-tetrahydrocannabinol, cannabichromene, and cannabigerol, was also seen in mature flowers of the treatment group plants, compared with the control group. Thus, cannabis plant infestation has an impact on its secondary metabolites, cannabinoids and terpenes, reflected by an overall increase in these compounds.
Find Pdf
Not Cannabis Specific
Can UVB Light Control Mold And Powdery Mildew?
California Lightworks September 17, 2019
https://news.californialightworks.co.. .owdery-mildew/
A fungal infestation can be massively devastating to a dedicated grower. After putting in your best efforts to cultivate a quality product under ideal growing conditions, it can be heartbreaking to see your plants destroyed by a relentless fungus.
And for many growers, spraying their grow room with nasty fungicides doesn’t feel like the ideal option, either.
This is why many gardeners are increasingly interested in UV light as a method for controlling mold and powdery mildew. If a simple light could help you save your plants from an untimely end, wouldn’t that be the best option? You would keep toxins out of the air and save yourself the expense and heartache of unusable plants.
Candidatus Phytoplasma asteris’ (group 16SrI) associated with a witches’?broom disease of Cannabis sativa in India
S. K. Raj, S. K. Snehi, M. S. Khan, S. Kumar
Plant Pathology, 57(6), 1173–1173. (2008).
doi:10.1111/j.1365-3059.2008.01920.x
Cannabis sativa, known as hemp, family Cannabaceae, occurs wild through out Himalayas and is cultivated in some provinces of India as a source of narcotic resin, fibre and edible oil (Anonymous, 1992). Symptoms of witches’ broom, similar to those associated with phytoplasmas, were observed in C. sativa plants growing wild along roadsides in Lakhimpur-Kheri, U.P., India during the summer of 2007. The diseased plants exhibited proliferation of branches with shortened internodes and reduced-size leaves , giving rise to the witches’ broom appearance. Total DNA was extracted from leaves of three symptom and three symptomless C. sativa plants. Nested PCR was carried out using P1/P6 (Deng & Hiruki, 1991) and R16F2n/R16R2 (Gundersen & Lee, 1996) universal primers specific to the phytoplasma 16S rRNA gene. PCR products of the expected size, ~1·5 kb and ~1·2 kb, respectively, were obtained from all plant samples with symptoms (3/3) but not from healthy ones. The three amplicons of 1·2 kb were sequenced and sequence data deposited in GenBank (Accession No. EU439257). BLAST search analysis of the 16S rRNA sequence of the C. sativa phytoplasma showed a 99% identity with those of phytoplasma members of 16SrI group, ‘Candidatus Phytoplasma asteris’, associated with periwinkle little leaf (EU375834); onion yellows (AP006628); carrot phytoplasma (EU215426); barley deformation (AY734453); and aster yellows (AY665676). Therefore, the C. sativa phytoplasma was identified as an isolate of the 16SrI group. A witches’ broom disease on a Cannabis sp. has been recently associated with a phytoplasma of elm yellows group (16SrV) in China (Zhao et al., 2007), but this is the first report of a 16SrI phytoplasma associated with witches’ broom on C. sativa in India.
Cannabinoid Receptors Are Absent in Insects
JOHN MCPARTLAND, VINCENZO DI MARZO, LUCIANO DE PETROCELLIS, LISON MERCER, AND MICHELLE GLASS
THE JOURNAL OF COMPARATIVE NEUROLOGY 436:423–429 (2001)
doi: 10.1002/cne.1078
The endocannabinoid system exerts an important neuromodulatory role in mammals. Knockout mice lacking cannabinoid (CB) receptors exhibit significant morbidity. The endocannabinoid system also appears to be phylogenetically ancient—it occurs in mammals, birds, amphibians, fish, sea urchins, leeches, mussels, and even the most primitive animal with a nerve network, the Hydra. The presence of CB receptors, however, has not been examined in terrestrial invertebrates (or any member of the Ecdysozoa). Surprisingly, we found no specific binding of the synthetic CB ligands [3
H]CP55,940 and [3 H]SR141716A in a panel of insects: Apis mellifera, Drosophila melanogaster, Gerris marginatus, Spodoptera frugiperda, and Zophobas atratus. A lack of functional CB receptors was confirmed by the inability of tetrahydrocannabinol (THC) and HU210 to activate G-proteins in insect tissues, utilizing a guanosine-59-O-(3-[35]thio)-triphosphate (GTPgS) assay. No orthologs of human CB receptors were located in the Drosophila genome, nor did we find orthologs of fatty acid amide hydrolase. This loss of CB receptors appears to be unique in the field of comparative
neurobiology. No other known mammalian neuroreceptor is understood to be missing in insects. We hypothesized that CB receptors were lost in insects because of a dearth of ligands; endogenous CB ligands are metabolites of arachidonic acid, and insects produce little or no arachidonic acid or endocannabinoid ligands, such as anandamide
Cannabis Crop Recommendation
Evergreen Growers Supply, LLC
https://www.evergreengrowers.com/med...endations.html
https://www.evergreengrowers.com/fil...1454530813.pdf
Cannabis, or marijuana, is grown for human consumption and therefore every effort should be made to grow the crop without the use of potentially harmful pesticides. Using beneficial insects and natural fungi to eliminate pests is the best way to ensure the cultivation of a clean and quality product for customers and/or patients.
Intensive modern breeding programs for medicinal characteristics have shifted cultivation from traditional, outdoor environments toward protected, indoor environments. Choosing to work indoors gives growers the ability to grow cannabis year-round and at a faster rate, but it also leaves their crops more susceptible to damaging pests. By creating a nurturing environment for their plants and eliminating the possibility of natural pests from outside, indoor growers inadvertently create very inviting breeding grounds for devastating pests.
Because cannabis has been mostly cultivated as a field crop, indoor growers often experience “stressed” plants which attract fungal pathogens and insect pests. Growers should do what they can to minimize stress by being proactive and working to prevent pests before they become a problem.
Cannabis Microbiome Sequencing: Implications for Cannabis Safety Testing
Kyle Boyar
DOI: 10.13140/RG.2.2.18308.17288
Conference: Cannabis Science Conference East April 2019
The cannabis plant and cannabis products are highly varied and complex matrices with each different product and route of administration having its own considerations for microbial testing. In the absence of rigorous study, this immature industry has decided to adopt methods commonly used in food testing to obtain information about the potential microbial hazards present. However, DNA sequencing of both the cannabis microbiome and the conditions before and after culturing tell a tale of inaccurate methodology. Many of the methods that are currently being employed are leading the cannabis industry astray, while blinding them to the real hazards that could be present. This presentation will walk you through the data that shows this and the discoveries we've made along the way that will hopefully open fresh discussions with new perspective on how to tackle microbiological contaminants in cannabis.
Cannabis microbiome sequencing reveals Penicillum Paxilli and the potential for Paxilline drug interactions with Cannabidiol
Kevin McKernan, Jessica Spangler, Yvonne Helbert, Ryan Lynch, Adrian Devitt-Lee, Wendell Orphe, Ted Foss, Chris Hudalla, Matthew Silva, Cindy Orser, Douglas Smith
https://www.medicinalgenomics.com/wp...4.06.15-pm.png
https://www.medicinalgenomics.com/wp...6_edits_v8.pdf
Traditional Cannabis microbial safety testing relies on counting colony forming units (CFU/g) that grow on a petri dish, 3M film or in a culture based system (Marcu, 2013). These systems take 3-5 days to culture fungi or microbes to detectable limits and cannot discern harmful microbes from beneficial microbes and often fail to detect fungi that synthesize compounds contra-indicated in the medicinal use of cannabinoids (McKernan et al.). As a result of this lack of specificity, overuse of fungicides is common in Colorado and California in 2016 (Wurzer, 2016).
An ideal microbial detection system would discern pathogenic from beneficial microbes. This can be challenging to do with selective medias and culturing conditions but can easily be accomplished with DNA based methods. We propose a 2 step method that first depletes or captures beneficial microbial DNA (Bacillus, Trichoderma etc.) onto a magnetic particle.
The supernatant of this particle thus contains the nonbeneficial microbes and can be tested by qPCR using ITS primers, as described in McKernan et al.
Cannabis microbiome sequencing reveals several mycotoxic fungi native to dispensary grade Cannabis flowers
DOI: 10.12688/f1000research.7507.2
https://biorxiv.org/content/biorxiv/e...30775.full.pdf
https://f1000research.com/articles/4-1422/v2
The Center for Disease Control estimates 128,000 people in the U.S. are hospitalized annually due to food borne illnesses. This has created a demand for food safety testing targeting the detection of pathogenic mold and bacteria on agricultural products. This risk extends to medical Cannabis and is of particular concern with inhaled, vaporized and even concentrated Cannabis products . As a result, third party microbial testing has become a regulatory requirement in the medical and recreational Cannabis markets, yet knowledge of the Cannabis microbiome is limited. Here we describe the first next generation sequencing survey of the fungal communities found in dispensary based Cannabis flowers by ITS2 sequencing, and demonstrate the sensitive detection of several toxigenic Penicillium and Aspergillus species, including P. citrinum and P. paxilli, that were not detected by one or more culture-based methods currently in use for safety testing.
Cannabis pathogens XI: Septoria spp. on Cannabis sativa, sensu stricto
John M. McPartland
Sydowia. 47:44-53 (1995)
https://www.zobodat.at/pdf/Sydowia_47_0044-0053.pdf
The genus Septoria Saccardo is quite unwieldy, containing about 2000 taxa. Sutton (1980) notes some workers have subdivided and studied the genus by geographical area. Grouping Septoria spp. by their host range is a more natural way of studying the genus in surmountable subunits. Six previous papers have revised Septoria spp. based on host studies (Punithalingham & Wheeler, 1965; Constantinescu, 1984; Sutton & Pascoe, 1987; Farr, 1991, 1992a, 1992b). Their results suggest Septoria host ranges are limited, and support the continued study of Septoria by host groupings. These compilations and comparisons are especially useful when cultures are lacking
Cannabis sativa as a Host of Rice Root Aphid (Hemiptera: Aphididae) in North America
Whitney Cranshaw, Suzanne Wainwright-Evans
Journal of Integrated Pest Management, Volume 11, Issue 1, 2020, 15,
DOI: 10.1093/jipm/pmaa008
Rice root aphid, Rhopalosiphum rufiabdominale (Sasaki), is a cosmopolitan species widespread in North America. Most records of this insect are of its association with roots of grasses and sedges, but known hosts also include numerous broadleaved plants both grown outdoors and in greenhouses. Indoor grown Cannabis sativa L., particularly when intensively grown for marijuana production, has also emerged as a common host for this insect in the United States and Canada. On this crop, it has an anholocyclic life cycle where it is almost entirely found in association with plant roots. Colonization of new plants is largely by alate forms that may emerge from soil in large numbers as plants near maturity.
Canmed Events Podcasts web talks
https://cannmedevents.com/coffee-tal...ource=hs_email
Characterization and pathogenicity of Fusarium solani causing foot rot on hemp (Cannabis sativa L.) in Southern Italy.
Sorrentino, R., Pergamo, R., Battaglia, V., Raimo, F., Cermola, M., & Lahoz, E.
Journal of Plant Diseases and Protection. (2019).
doi:10.1007/s41348-019-00265-1
Symptoms of foot rot were observed on hemp (Cannabis sativa) plants in Campania region (Southern Italy) in 2018. The symptoms consisted of brownish areas along the main stem followed by wilting and dropping of leaves. The bark was easily removed in correspondence of the lesions since the inner part of the cortex was afected too. The causal agent was isolated on potato dextrose agar and stored at the Research Centre for Cereal and Industrial Crops of Caserta. On carnation leaf agar, the fungus produced long monophialidic conidiogenous cells and both micro- and macroconidia. The frst were oval, ellipsoid and fusiform prevalently 0- and 1-septate with length 9.84–12.68 ?m and width 2.61–4.15 ?m, while falciform macroconidia were prevalently 3- and 4-septate with length and width 23.87–29.23×3.22–4.98, respectively. Chlamydospores were observed intercalated in the hyphae, globose to oval in shape with smooth or rough wall, 5–15 ?m in diameter. Morphologically, the fungus was identifed as Fusarium solani, which was also supported by the BLASTn and the phylogenetic analysis of the sequences of the internal transcribed spacer and elongation factor 1-? genes. Koch’s postulates confrmed F. solani as the etiological agent of the observed disease. Cluster analysis applied to the two genes demonstrated that our isolates belong to the clade 3 of the F. solani species complex.
Characterization of Stolbur (16SrXII) Group Phytoplasmas Associated with Cannabis sativa Witches'-broom Disease in Iran
Fereshteh Vali Sichani, Masoud Bahar and Leila Zirak
Plant Pathology Journal 2011 Volume:10 Issue:4 Page 161-167
DOI: 10.3923/ppj.2011.161.167
A new disease of hemp plants characterized by witches'-brooms and stunting symptoms was appeared in Yazd province in the centre of Iran. Phytoplasma infections were detected in symptomatic hemps by polymerase chain reaction (PCR) amplifications using phytoplasma universal primer pair P1/P7 followed by R16F2n/R16R2 in nested PCR. Restriction fragments length polymorphism (RFLP) analysis results using CfoI restriction enzyme confirmed that the hemp witches'-broom phytoplasma isolates are related to stolbur group. Also, virtual RFLP analysis revealed that hemp witches'-broom phyutoplasmas in Iran are different from members of other 16SrXII subgroups. Sequence analysis of partial 16S rRNA gene indicated that the phytoplasmas associated with hemp in Iran shared high similarity with ‘Candidatus Phytoplasma solani’ and other phytoplasmas related to stolbur group. This research is the first report of hemp infection with phytoplasmas related to stolbur group.
Coffee Talk With Dr David Joly about PM genes and how to breed Cannabis with them.
https://cannmedevents.com/2021/09/29...d-joly-phd/?ut
• How PM infects cannabis plants and how environmental conditions play a role
• The prevention and remediation options cannabis cultivators currently have
• The difference between PM resistance and PM susceptibility and how variations both can affect the severity of infection
• How breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
• What are MLO genes and how do they affect PM susceptibility
• How MLO genes were used to breed our PM susceptibility in other crops
• The importance of having a quality reference genome to investigate genes of interest.
Comparative genomics of a cannabis pathogen reveals insight into the evolution of pathogenicity in Xanthomonas.
Jacobs, J. M., Pesce, Cã©., Lefeuvre, P., & Koebnik, R.
Frontiers in Plant Science, 6. (2015).
doi:10.3389/fpls.2015.00431
Pathogenic bacteria in the genus Xanthomonas cause diseases on over 350 plant species, including cannabis (Cannabis sativa L.). Because of regulatory limitations, the biology of the Xanthomonas-cannabis pathosystem remains largely unexplored. To gain insight into the evolution of Xanthomonas strains pathogenic to cannabis, we sequenced the genomes of two geographically distinct Xanthomonas strains, NCPPB 3753 and NCPPB 2877, which were previously isolated from symptomatic plant tissue in Japan and Romania. Comparative multilocus sequence analysis of housekeeping
genes revealed that they belong to Group 2, which comprises most of the described species of Xanthomonas. Interestingly, both strains lack the Hrp Type III secretion system and do not contain any of the known Type III effectors. Yet their genomes notably encode two key Hrp pathogenicity regulators HrpG and HrpX, and hrpG and hrpX are in the same genetic organization as in the other Group 2 xanthomonads. Promoter prediction of HrpX-regulated genes suggests the induction of an aminopeptidase, a lipase and two polygalacturonases upon plant colonization, similar to other plantpathogenic xanthomonads. Genome analysis of the distantly related Xanthomonas maliensis strain 97M, which was isolated from a rice leaf in Mali, similarly demonstrated the presence of HrpG, HrpX, and a HrpX-regulated polygalacturonase, and the absence of the Hrp Type III secretion system and known Type III effectors. Given the observation that some Xanthomonas strains across distinct taxa do not contain hrpG and hrpX, we speculate a stepwise evolution of pathogenicity, which involves (i) acquisition of key regulatory genes and cell wall-degrading enzymes, followed by (ii) acquisition of the Hrp Type III secretion system, which is ultimately accompanied by (iii) successive acquisition of Type III effectors.
NOT CANNABIS SPECIFIC but this virus is found in Cannabis
Complete Genome Sequence of a Hop Latent Virus Infecting Hop Plants
Yeonhwa Jo, Hoseong Choi, and Won Kyong Chocorresponding author
Genome Announc. 2015 Mar-Apr; 3(2): e00302-15.
doi: 10.1128/genomeA.00302-15
he hop latent virus is a single-stranded RNA virus that mainly infects hop plants. Here, we report the complete genome sequence of a hop latent virus, which was de novo assembled by RNA sequencing (RNA-seq). Our study indicates that transcriptome data are useful for identifying a complete viral genome
Complete sequence of a cryptic virus from hemp (Cannabis sativa)
Angelika Ziegler • Jaroslav Matous?ek • Gerhard Steger • Jorg Schubert
Arch Virol
DOI 10.1007/s00705-011-1168-8
Hemp (Cannabis sativa) was found to be a useful propagation host for hop latent virus, a carlavirus. However, when virus preparations were analysed by electron microscopy, along with the expected filamentous particles, spherical particles with a diameter of around 34 nm were found. RNA from virus preparations was purified, and cDNA was prepared and cloned. Sequence information was used to search databases, and the greatest similarity was found with Primula malacoides virus 1, a putative new member of the genus Partitivirus. The full sequences of RNA 1 and RNA 2 of this new hemp cryptic virus were obtained.
Contrasting Roles of Cannabidiol as an Insecticide and Rescuing Agent for Ethanol–induced Death in the Tobacco Hornworm Manduca sexta.
Park, S.-H., Staples, S. K., Gostin, E. L., Smith, J. P., Vigil, J. J., Seifried, D., … Heuvel, B. D. V.
Scientific Reports, 9(1). (2019).
doi:10.1038/s41598-019-47017-7
Cannabis sativa, also known as marijuana or hemp, produces a non-psychoactive compound cannabidiol (CBD). To investigate the defensive role of CBD, a feeding preference assay was performed with tobacco hornworm Manduca sexta. The larvae clearly show feeding preference towards the Cannabis tissue containing low CBD over high CBD. While the larva avoided the high CBD diet, we investigated detrimental efects of CBD in the insects’ diet. Contrasted to the performance on low CBD-infused artifcial diet (AD), larvae reared on the high CBD diet sufer signifcantly reduced growth and increased mortality. Through testing diferent carriers, we found that the increase of EtOH in the diet is negatively correlated with insect development and behaviors. Notably, CBD treatment signifcantly improved ethanol-intoxicated larval survival rate by 40% and also improved diet searching activity, resulting in increased diet consumption. Electrophysiology results revealed that the CBD-treated ganglia had delayed but much larger response with electric stimuli in comparison to the larvae reared on AD only and EtOH-added diet. Our results show CBDs’ defensive role against pest insects, which suggests its possible use as an insecticide. We also provide evidence that CBD alleviates alcohol-induced stress; consequently, improving the performance and viability of M. sexta larvae.
Cross-Infectivity of Powdery Mildew Isolates Originating from Hemp (Cannabis sativa) and Japanese Hop (Humulus japonicus) in New York.
Weldon, W. A., Ullrich, M. R., Smart, L. B., Smart, C. D., & Gadoury, D. M.
Plant Health Progress, 47–53.(2020).
doi:10.1094/php-09-19-0067-rs
In the recent decade, agricultural production of both hemp (Cannabis sativa) and hop (Humulus lupulus) has expanded throughout the Pacific Northwest, Midwest, and Eastern United States to support the growing industries for which these plants are key components. The significant and rapidly expanding overlap of production regions of these two Cannabaceae plant family members creates a potential dispersal route for organisms that are pathogenic to both hosts. Powdery mildew is a disease of high economic impact in both hemp and hop production systems, yet it was largely unknown whether the powdery mildew fungi commonly associated with hemp could also be pathogenic on hop, and vice versa. We isolated Golovinomyces spadiceusgrowing upon hemp in New York production greenhouses and Podosphaera macularisfrom feral hop (H. japonicus) plantings also in New York. Herein, we report the pathogenicity of P. macularis associated with hop to C. sativa cultivars ‘Anka’ and ‘Wild Horse’ and pathogenicity of G. spadiceus toward hop. The potential for P. macularis to establish, produce viable, infectious conidia, and undergo sexual recombination on hemp could complicate efforts to exclude the MAT1-2 mating type of P. macularis from western North America and could facilitate the spread of races pathogenic toward ‘Cascade’ hop, and hop cultivars with R6-based resistance to P. macularis, including ‘Nugget’. Further assessment of the pathogenicity of diverse P. macularis isolates, in both geographic origin and the range of hop species, is necessary to better understand the dispersal risk of P. macularis on hemp.
Dark Heart Nursery Identifies Major Virus Behind ‘Dud’ Cannabis Plants
https://cannabisnow.com/dark-heart-n...nnabis-plants/
Dark Heart Nursery has identified that the HpLVd virus — said to infect up to 30 percent of crops — causes cannabis plants to grow poorly.
Jimi Devine
In an announcement likely to send shockwaves through the cannabis industry, Dark Heart Nursery announced on Thursday it had positively identified hop latent viroid (HpLVd) as the cause of “dudding” in cannabis plants, resulting in lost vigor.
After identifying HpLVd is the culprit behind poor cannabis plant performance, Dark Heart started testing for it and eliminating it in 2018.
Dark Heart Nursery Founder Dan Grace told Cannabis Now that the research the nursery started in regards to HpLVd would typically be done by universities as a service to industry. “You look at UC Davis and they have a department called Foundation Plant Services,” he said. “The work that we’ve done here with cannabis, they would normally do for grapes, sweet potatoes, almonds and stuff like that. It’s almost always a government service to the industry.”
Dark Heart Nursery identifies pot pathogen BTW, Dark Heart was not the first to ID this in Cannabis
https://www.dailydemocrat.com/2019/0...-pot-pathogen/
OAKLAND — Dark Heart Nursery has announced that it is the first organization to positively identify hop latent viroid as the cause of “dudding” in cannabis.
Since 2018, Dark Heart, which has growing operations in Yolo County, has also been successfully testing for and eliminating HpLVd through a patent-pending clean plant process.
On the heels of this research, the company has also announced that project lead Dr. Jeremy Warren has officially joined DHN as director of Plant Health.
“The positive identification of the HpLVd pathogen and our patent-pending clean plant process to test for and eliminate it represent a significant advance towards keeping cannabis crops healthy and supporting long-term business growth for cultivators,” said Dan Grace, founder and president of Dark Heart Nursery. “With Dr. Warren at the helm, we are incredibly excited to now offer diagnostic and curative services for HpLVd to licensed cannabis businesses in California, as well as continue our research in identifying and eradicating additional cannabis-infecting pathogens.”
“Dudding” is a colloquial name for a variety of symptoms, which include loss of vigor, stunting, reduction in yield, reduction in potency and changes in morphology. The syndrome was codified in 2017 by Dr. Rick Crum who first coined the phrase “Putative Cannabis Infectious Agent” to describe it.
In 2015, Dr. Crum reported that as many as 35 percent of observed plants showed PCIA symptoms.
In 2017, Dark Heart Nursery began working with Dr. Warren to determine the cause of PCIA. Symptomatic and asymptomatic plants were collected, and next generation RNA sequencing was performed to determine a probable cause of the disease.
After analysis of the results in November 2017, it was determined that Hop latent viroid (HpLVd) was the most likely candidate pathogen. A genetic test was then developed to aid in differentiating healthy plants from infected plants.
In 2014, Dark Heart established the cannabis industry’s first tissue culture laboratory. Among other areas of research, this lab has focused on the development of clean plant protocols through which cannabis can be cured of pathogens and cataloged for later use.
Not Cannabis specific
Deep learning models for plant disease detection and diagnosis
Konstantinos P. Ferentinos
Computers and Electronics in Agriculture 145 (2018) 311–318
DOI: 10.1016/j.compag.2018.01.009
https://www.researchgate.net/publica..._and_diagnosis
In this paper, convolutional neural network models were developed to perform plant disease detection and diagnosis using simple leaves images of healthy and diseased plants, through deep learning methodologies. Training of the models was performed with the use of an open database of 87,848 images, containing 25 different plants in a set of 58 distinct classes of [plant, disease] combinations, including healthy plants. Several model architectures were trained, with the best performance reaching a 99.53% success rate in identifying the corresponding [plant, disease] combination (or healthy plant). The significantly high success rate makes the model a very useful advisory or early warning tool, and an approach that could be further expanded to support an integrated plant disease identification system to operate in real cultivation conditions
NOT CANNABIS SPECIFIC but the virus is found in Cannabis
Detection and molecular analysis of Hop latent virus and Hop latent viroid in hop samples from Poland
July 2014Journal fur Kulturpflanzen 66(7):248-254
DOI: 10.5073/JFK.2014.07.04
Angelika Ziegler, Magdalena Kawka, Marcin Przybys, Jl Schubert
Monitoring the occurrence of virus diseases in plants is important for the implementation of early control measures and prevention of further disease spread. In Poland, in 2004 a health programme for hop was started to eliminate viruses and viroids. In 2012/13, in vitro plants, samples from the IUNG-PIB experimental station and commercial hop gardens in Poland were tested for Hop latent virus (HpLV), and Hop latent and Hop stunt viroids (HpLVd and HpSVd). For virus testing, RT-PCR and ELISA methods were used. In order to detect hop viroids, RT-PCR was employed. The overall incidence of HpLV and hop viroids was lower than reported before the start of the programme. Cloning and sequencing revealed that the HpLV and the HpLVd from Polish sources are very similar to the type sequences and the Czech sources.
Developing Insect Pest Management Systems for Hemp in the United States: A Work in Progress
Whitney Cranshaw, Melissa Schreiner, Kadie Britt, Thomas P. Kuhar, John McPartland, and Jerome Grant
Journal of Integrated Pest Management, (2019)
doi: 10.1093/jipm/pmz023
Hemp (Cannabis sativa L.) is now being grown within the United States over a much broader geographic area and for different uses than during its last period of significant production that ended after World War II. Within the past 3 yr, a large number of arthropod species have been documented to feed on hemp in the United States. Among key pest species, corn earworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae), has demonstrated greatest potential for crop injury, being particularly damaging to flower buds. Hemp russet mite, Aculops cannibicola (Farkas), and cannabis aphid, Phorodon cannabis Passerini, are the two species observed most damaging among those that suck plant fluids. Eurasian hemp borer, Grapholita delineana Walker, is widely present east of the Rocky Mountains and appears to have potential to significantly damage both flower buds and developing seeds. Numerous species of caterpillars, grasshoppers, and beetles chew hemp foliage; the severity of these defoliation injuries appears to be minimal, but needs further study. Similarly, numerous seed feeding hemipterans, most notably stink bugs and Lygus bugs, are regularly found in the crop but injury potential remains unclear. Some preliminary efforts have been made to develop integrated pest management strategies for these insects, particularly for corn earworm. Future research can be expected to rapidly resolve many of the data gaps that presently restrict advancing pest management on the crop. However, a major confounding issue involves the use of pesticides on hemp. Federal agencies have not yet provided clear direction on this issue, and regulatory decisions have subsequently devolved to the states.
Differentiating Powdery Mildew from False Powdery Mildew
John McPartland, Karl Hillig
April 2008 Journal of Industrial Hemp 13(1):78-87
DOI: 10.1080/15377880801898758
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring color illustrations of signs and symptoms. The fungus Trichothecium roseum produces a white fuzz that covers branches, leaves, and flowering tops of hemp. These symptoms have been confused with true powdery mildew, caused by Sphaerotheca macularis. We illustrate the differences between disease caused by Trichothecium roseum (henceforth dubbed “false powdery mildew”) and disease caused by Sphaerotheca macularis.
While the resistance gene PM1 is an important discovery it is actually more important to eliminate any MLO susceptibility genes in a Cannabis variety, to have no PM. Breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
*Discovery and Genetic Mapping of PM1, a Powdery Mildew Resistance Gene in Cannabis sativa L.
Paul D. Mihalyov and Andrea R. Garfinkel
Front. Agron. 3:720215. (2021)
doi: 10.3389/fagro.2021.720215
https://www.frontiersin.org/articles...170000_ARTICLE
Powdery mildew is among the most common diseases of both hemp- and marijuana-type cultivated Cannabis sativa . Despite its prevalence, no documented studies have characterized sources of natural genetic resistance in this pathosystem. Here we provide evidence for the first resistance (R ) gene in C. sativa , represented by a single dominant locus that confers complete resistance to an isolate of the powdery mildew pathogen Golovinomyces ambrosiae , found in the Pacific Northwest of the United States. Linkage mapping with nearly 10,000 single nucleotide polymorphism (SNP) markers revealed that this R gene (designated PM1 ) is located on the distal end of the long arm of one of the largest chromosomes in the C. sativa genome. According to reference whole genome sequences and Sanger sequencing, the marker was tentatively placed in a cluster of R genes of the nucleotide-binding site (NBS) and leucine-rich repeat (LRR) protein type. PM1 ’s dominant behavior, qualitative penetrance, and a co-segregating qPCR marker to track its inheritance were confirmed in two separate genetic backgrounds totaling 185 recombinant F1 plants. The goal of this study is to provide a foundation for the discovery and characterization of additional sources of genetic resistance to pathogens that infect C. sativa .
Effect of Cannabis sativa L. root, leaf and inflorescence ethanol extracts on the chemotrophic response of entomopathogenic nematodes.
Žiga Laznik & Iztok Jože Košir & Katarina Košmelj & Jana Murovec & Anamarija Jagodi? & Stanislav Trdan & Darja Kocjan A?ko & Marko Flajšman
Plant and Soil. (2020).
doi:10.1007/s11104-020-04693-z
Aims Soils represent the natural habitat of entomopathogenic nematodes (EPNs). When moving in soil, EPNs are oriented to follow a chemical signal (chemotaxis). Cannabis sativa L. is known to secrete a very wide spectrum of secondary metabolites. Ethanol extracts (EE) of different C. sativa L. organs were used to study the effect on EPN chemotaxis. Methods The root, leaf and inflorescence EE of two hemp varieties and two medical cannabis breeding lines were used in laboratory chemotaxis assays with three EPN species (Steinernema carpocapsae, S. feltiae and Heterorhabditis bacteriophora) at 20 and 25 °C. The content of terpenes and cannabinoids in C. sativa L. inflorescences was measured as well. Results Overall, EPNs were most attracted or repelled by inflorescence extracts, followed by leaves and roots. The most abundant terpene in hemp inflorescences was trans caryophyllene (38.2% on average), the highest contents of total cannabidiol, total cannabigerol and total tetrahydrocannabinol were 9.65%, 0.89% and 0.62%, respectively. Conclusions The attraction effect of S. sativa L. EE is a highly interesting outcome and could lead to the development of attractant compounds in EPN biological control. Cannabinoids and terpenes may be responsible for pronounced effects on EPN chemotaxis.
Not Cannabis specific
Effect of UV-exposure on colony formation of Xanthomonas fragariae in vitro
G.J.T. Kessel & M.T. Schilder
https://cleanlight.nl/wp-content/upl...nas-report.pdf
Not Cannabis Specific
Effect of UV - exposure on germination of sporangia of Phytophthora infestans
G.J.T. Kessel & M.G. Förch
https://cleanlight.nl/wp-content/upl...ytophthora.pdf
The oomycete Phytophthora infestans, the cause of late blight in potato and tomato, is considered one of the most important pathogens of potatoes worldwide (Hooker 1981). P. infestans affects foliage and stems, reducing the photosynthetic capacity of the crop and therefore leading to yield reduction. In addition, it affects tubers which reduces both, yield quantity and quality. In the past, crop losses due to late blight have been estimated to account for 10 to 15 percent of the total global annual potato production (Anonymous, 1996). The economic value of the crop lost, plus the cost of crop protection amount to US $ three billion annually (Duncan, 1999). In the Netherlands, the cost of crop protection amounts to
approximately 40 million euro annually on a total of 160 -180 thousand hectares with an average yield of 45 tonnes fresh weight per hectare.
The life cycle of P. infestans can be separated into an asexual cycle and a sexual cycle. The asexual cycle is the driving force behind rapid polycyclic epidemics that can be observed in potato crops during the growing season. Numerous sporangia are produced on infected leaflets and stems. Sporangia are released into the atmosphere under dry conditions or they can be washed into the ridge by rain. When released into the atmosphere sporangia may cause new foliar infections in the same crop or neighbouring crops. When washed into the soil, sporangia may cause tuber infections. In both cases, the ambient temperature determines whether the sporangium germinates directly (optimum at ±23°C) or indirectly (optimum at ±12°C). Direct germination results in formation of a germ tube. Indirect germination results in formation of motile zoospores. When zoospores loose their flagellae, they become cystospores which germinate and infect through a germ tube
Effects of cold plasma, gamma and e-beam irradiations on reduction of fungal colony forming unit levels in medical cannabis inflorescences
Shachar Jerushalmi, Marcel Maymon, Aviv Dombrovsky and Stanley Freeman
Journal of Cannabis Research (2020) 2:12
doi: 10.1186/s42238-020-00020-6
Background: The use of medical cannabis (MC) in the medical field has been expanding over the last decade, as more therapeutic beneficial properties of MC are discovered, ranging from general analgesics to anti-inflammatory and anti-bacterial treatments. Together with the intensified utilization of MC, concerns regarding the safety of usage, especially in immunocompromised patients, have arisen. Similar to other plants, MC may be infected by fungal plant pathogens (molds) that sporulate in the tissues while other fungal spores (nonpathogenic) may be present at high concentrations in MC inflorescences, causing a health hazard when inhaled. Since MC is not grown under sterile conditions, it is crucial to evaluate current available methods for reduction of molds in inflorescences that will not damage the active compounds. Three different sterilization methods of inflorescences were examined in this research; gamma irradiation, beta irradiation (e-beam) and cold plasma to determine their efficacy in reduction of fungal colony forming units (CFUs) in vivo.
Methods: The examined methods were evaluated for decontamination of both uninoculated and artificially inoculated Botrytis cinerea MC inflorescences, by assessing total yeast and mold (TYM) CFU levels per g plant tissue. In addition, e-beam treatment was also tested on naturally infected commercial MC inflorescences.
Results: All tested methods significantly reduced TYM CFUs at the tested dosages. Gamma irradiation reduced CFU levels by approximately 6- and 4.5-log fold, in uninoculated and artificially inoculated B. cinerea MC inflorescences, respectively. The effective dosage for elimination of 50% (ED50)TYM CFU of uninoculated MC inflorescence treated with e-beam was calculated as 3.6 KGy. In naturally infected commercial MC inflorescences, e-beam treatments reduced TYM CFU levels by approximately 5-log-fold. A 10 min exposure to cold plasma treatment resulted in 5- log-fold reduction in TYM CFU levels in both uninoculated and artificially inoculated B. cinerea MC inflorescences.
Conclusions: Although gamma irradiation was very effective in reducing TYM CFU levels, it is the most expensive and complicated method for MC sterilization. Both e-beam and cold plasma treatments have greater potential since they are cheaper and simpler to apply, and are equally effective for MC sterilization.
Not cannabis specific
ELIMINATION OF HOP LATENT VIROID FROM HOP PLANTS BY COLD TREATMENT AND MERISTEM TIP CULTURE
M. Grudzińska, E. Solarska, A. Czubacka, M. Przybyś and A. Fajbuś
http://www.up.poznan.pl/~ptfit1/pdf/...PP40_21-30.pdf
Cold treatment and meristem tip culture were used for elimination of Hop latent viroid from four cultivars of hop (Humulus lupulus). Efficiency of the method was compared for hop cultivars,cold treatments of tested plants and time of meristems excision. HLVd was successfully eliminated from infected plants after one month of cold treatment. Good results were also obtained after cooling tested plants during winter. Excising the meristems as soon as possible after ending of plant cooling was an important factor in HLVd elimination. The effectiveness of viroid elimination depended also on hop cultivar. The use of a very sensitive diagnostic method RT-PCR to confirm complete viroid elimination from infected plants resulted in obtaining a population of HLVd-free hop plants,which remained healthy also after dormancy period.
Not Cannabis Specific
Elimination of Hop Stunt Viroid (HSVd) from Infected Peach and Pear Plants Using Cold Therapy and Chemotherapy
Australian Journal of Basic and Applied Sciences, 4(1): 54-60, 2010
Kh.A. El-Dougdoug, Osman M.E., Abdelkader Hayam S., Dawoud Rehab, A.,and Elbaz Reham M.
https://www.researchgate.net/profile...a97c000000.pdf
Hop stunt viroid (HSVd) was detected in several pear and peach trees collected during summer season by RT-PCR and molecular hybridization assays. Hop stunt viroid disease was very severe in summer; however, the multiplication of viroid decreases drastically in winter. In this study, the shoots cut from Prunus persicae cv. Florida prince and Pierre corneille cv. Balady infected plants treated by cold therapy, thermotherapy and/or chemotherapy was used successfully to eliminate Hop stunt viroid. Results demonstrated that application of 10 to 20 mg/L Virazole. followed by cold
therapy for 30 days at 4ÅãC in vitro gave a survival rate of 63 and 75% for pear and peach respectively. The presence of viroid in recovered plants was evaluated by tissue print hybridization technique. In vitro cold therapy combined with chemotherapy using shoot tip culture eliminates HSVd from infected peach and pear trees and reduces the risk of introducing this pathogen to Egypt.
Elimination of hop latent viroid upon developmental activation of pollen nucleases
Jaroslav Matousek , Lidmila Orctová, Josef Skopek, Karel Pesina, Gerhard Steger
Biol Chem. 2008 Jul.
DOI: 10.1515/BC.2008.096
https://www.academia.edu/19146337/El...op_latent_viro id_upon_developmental_activati on_of_pollen_nucleases
Hop latent viroid (HLVd) is not transmissible through hop generative tissues and seeds. Here we describe the process of HLVd elimination during development of hop pollen. HLVd propagates in uninucleate hop pollen, but is eliminated at stages following first pollen mitosis during pollen vacuolization and maturation. Only traces of HLVd were detected by RT-PCR in mature pollen after anthesis and no viroid was detectable in in vitro germinating pollen, suggesting complete degradation of circular and linear HLVd forms. The majority of the degraded HLVd RNA in immature pollen included discrete products in the range of 230-100 nucleotides and therefore did not correspond to siRNAs. HLVd eradication from pollen correlated with developmental expression of a pollen nuclease and specific RNAses. Activity of the pollen nuclease HBN1 was maximal during the vacuolization step and decreased in mature pollen. Total RNAse activity increased continuously up to the final steps of pollen maturation. HBN1 mRNA, which is abundant at the uninucleate microspore stage, encodes a protein of 300 amino acids (34.1 kDa, isoeletric point 5.1). Sequence comparisons revealed that HBN1 is a homolog of S1-like bifunctional plant endonucleases. The developmentally activated HBN1 and pollen ribonucleases could participate in the mechanism of HLVd recognition and degradation.
Emerging diseases of Cannabis sativa and sustainable management
Zamir K Punja
Pest Management Science (2021)
DOI: 10.1002/ps.6307
No PDF of this
Cultivation of cannabis plants (Cannabis sativa L., marijuana) has taken place worldwide for centuries. In Canada, legalization of cannabis in October 2018 for the medicinal and recreational markets has spurned interest in large‐scale growing. This increased production has seen a rise in the incidence and severity of plant pathogens, causing a range of previously unreported diseases. The objective of this review is to highlight the important diseases currently affecting the cannabis and hemp industries in North America and to discuss various mitigation strategies. Progress in molecular diagnostics for pathogen identification and determining inoculum sources and methods of pathogen spread have provided useful insights. Sustainable disease management approaches include establishing clean planting stock, modifying environmental conditions to reduce pathogen development, implementing sanitation measures, and applying fungal and bacterial biological control agents. Fungicides are not currently registered for use and hence there are no published data on their efficacy. The greatest challenge remains in reducing microbial loads (colony‐forming units) on harvested inflorescences (buds). Contaminating microbes may be introduced during the cultivation and post‐harvest phases, or constitute resident endophytes. Failure to achieve a minimum threshold of microbes deemed to be safe for utilization of cannabis products can arise from organic cultivation methods or application of beneficial biocontrol agents. The current regulatory process for approval of cannabis products presents a challenge to producers utilizing biological control agents for disease management.
Endophytic fungi harbored in Cannabis sativa L.: diversity and potential as biocontrol agents against host plant-specific phytopathogens
Parijat Kusari & Souvik Kusari & Michael Spiteller & Oliver Kayser
Fungal Diversity (2013) 60:137–151
DOI 10.1007/s13225-012-0216-3
The objective of the present work was isolation, phylogenetic characterization, and assessment of biocontrol potential of endophytic fungi harbored in various tissues (leaves, twigs, and apical and lateral buds) of the medicinal plant, Cannabis sativa L. A total of 30 different fungal endophytes were isolated from all the plant tissues which were authenticated by molecular identification based on rDNA ITS sequence analysis (ITS1, 5.8S and ITS2 regions). The Menhinick’s index revealed that the buds were immensely rich in fungal species, and Camargo’s index showed the highest tissue-specific fungal dominance for the twigs. The most dominant species was Penicillium copticola that could be isolated from the twigs, leaves, and apical and lateral buds. A detailed calculation of Fisher’s log series index, Shannon diversity index, Simpson’s index, Simpson’s diversity index, and Margalef’s richness revealed moderate overall biodiversity of C. sativa endophytes distributed among its tissues. The fungal endophytes were challenged by two host phytopathogens, Botrytis cinerea and Trichothecium roseum, devising a dual culture antagonistic assay on five different media. We observed 11 distinct types of pathogen inhibition encompassing a variable degree of antagonism on changing the media. This revealed the potential chemodiversity of the isolated fungal endophytes not only as promising resources of biocontrol agents against the known and emerging phytopathogens of Cannabis plants, but also as sustainable resources of biologically active and defensive secondary metabolites.
Endophytic microflora harbored in Cannabis sativa
Parijat Kusari, Souvik Kusari, Michael Spiteller, Oliver Kayser
Technische Universitat Dortmund
Cannabis sativa is an annual herbaceous plant of the Cannabaceae family from central Asia. Cannabinoids are one of the major secondary metabolites of this plant, which are known to have important therapeutic benefits like analgesic, anti-inflammatory, neuro-protective, appetite-stimulant and many more. Endophytic microorganisms (endophytes) still remain an unexplored group of very promising organism with diverse potential for exploitation, that are capable of producing bioactive secondary metabolites, sometimes even those natural products considered exclusive to their host plants. Thus, these microorganisms are important not only from molecular and biochemical standpoint but also from the ecological perspectives.
Find Pdf
(In Turkish)
ENDÜSTR?YEL KENEV?RDE HASTALIK, ZARARLI ve YABANCI OT MÜCADELES?/PEST, DISEASE AND WEED CONTROL IN INDUSTRIAL HEMP
Huseyin Onen
https://www.researchgate.net/publica...NDUSTRIAL_HEMP
Bütün kültür bitkilerinde oldu?u gibi kenevir tar?m?nda da bitki koruma etmenleri üretimin en önemli s?n?rlay?c? faktörler aras?nda yer almaktad?r. Ancak ülkemizde kenevir üretimine yakla??k 20 y?ld?r ara verilmesi kenevir üretim sürecinde uygulanan kültürel i?lemlere ili?kin bilgi birikiminde de erozyona neden olmu?tur. Kenevir üretiminin yayg?nla?t?r?lmas?n?n gündemde oldu?u dikkate al?nd???nda; üretim sürecinde meydana gelen bo?luk da göz önünde bulundurularak, bitki koruma sorunlar? ve bunlar?n çözümü konusunda bilgi eksikli?inin giderilmesini zorunluluk haline getirmektedir. Bu dü?ünceden yola ç?k?larak, “kenevir tar?m? için bitki koruma el kitab?” mahiyetinde ki mevcut çal??mayla; öncelikle kenevirde görülen yabanc? ot türleri ve bunlar?n idaresinde izlenecek prosedürlerin ele al?nmas? hedeflenmi?tir. Ancak konu bütünlü?ünün sa?lanmas? amac?yla kenevir bitkisinin genel özelliklerine de?inilmi?, dünya genelinde kenevirde sorun olu?turan ve ekim alanlar?n?n geni?lemesiyle birlikte ülkemizde de kar??la?abilece?imiz muhtemel hastal?k etmenleri ile zararl?lar ve bunlar?n kontrolü konular? da ele al?nm??t?r. Geni? bir derleme mahiyetindeki bu el kitab?n?n ba?ta üreticiler olmak üzere konuyla alakal? teknik personel ve ara?t?r?c?lara faydal? olmas? en büyük sevinç kayna??m olacakt?r. Di?er taraftan herboloji konusunda Türkçe kaynak yetersizli?i dikkate al?nd???nda; haz?rlanan bu el kitab?n?n gelece?in Ziraat Mühendisi adaylar? Ziraat Fakültelerinin çok de?erli ö?rencilerine yard?mc? kaynak olarak i? görebilmesi de amaçlanm??t?r. Daha geni? kitlelere ula??labilmesi için el kitab? elektronik olarak haz?rlanm?? olup ücretlidir. Ücreti; en az bir kez okumak ve varsa öneri/ele?tirilerin yazara iletilmesidir. Bu durum mevcut kayna??n ihtiyaçlar do?rultusunda geni?letilmesi için önem ta??maktad?r. Faydal? olmas? temennisi ile…
Industrial hemp production areas in Turkey have been recently intended to increase, therefore intensive research and development activities are being conducted to achieve the goal. Introducing the hemp, which was removed from the agricultural crop rotation many years ago, into the crop rotation will bring new crop-pest interactions to the agenda. Therefore detailed studies on plant protection (pests, diseases and weeds management) will be needed for a successful industrial hemp production. In this context, this handbook (in Turkish) was compiled from a detailed literature survey and observations on hemp cultivation areas in our country. The handbook is aimed to inform the producers about plant protection (pest, disease and weed management) in industrial hemp production, with a special emphasis on weeds and their management. The study also intended to provide scientific information to researches on integrated pest/weed management in industrial hemp production, and education material for students in agricultural faculties of the country. In the handbook; I) Pests, pathogens and weeds constitute an inseparable complex in the agro-ecosystems. Therefore all problematic agents (diseases and pests) in hemp production areas along with weeds have been discussed in general. II) Problems arising from pests and pathogens in hemp production areas are addressed in broad terms, while the problems caused by the weeds have been discussed in a wider context. III) Weeds causing problems in the hemp fields worldwide have been listed, parasitic weed (dodder and broomrape) species have been determined, and the noxious weeds in hemp production have been documented based on observations in different parts of the country. IV) Strategies that can be used under the “Integrated Pest Management (IPM)” context in industrial hemp fields have been summarized based on the results obtained in different regions of the world. V) The results of scientific studies revealed that the plant is extremely competitive as a consequence of allopathic effect of hemp, and the plant can easily suppress the weeds with cultural measures such as proper site selection, using competitive varieties, early planting, adjusting the plant density, and appropriate fertilization and irrigation etc. Nevertheless, the weed problems that may arise can be easily overcome by soil cultivation. In addition, the plant has been determined also as tolerant to pathogens/pests. Therefore, pesticide use may not be needed in industrial hemp production areas. VI) The volunteer hemps which have similar characteristics with the problematic weeds in agro ecosystems can arise as a weed especially in crops such as cereals and sunflower. The literature review revealed that monitoring the changes in weed population depending on ecological conditions in agricultural areas is needed, and studies on comparison of different hemp varieties, especially local varieties, for weed competitiveness, and regional critical period studies considering the ecological conditions and possible changes in weed populations will be beneficial. In addition, with regard to weed control, studies depending on the purpose of production (fiber and seed) should be carried out to determine the most appropriate sowing time, sowing depth and sowing rate, and the number and timing of the mechanical weed control (hoeing) should be determined. Moreover, studies such as screening pesticides (including herbicides) candidates are needed to determine the potential pesticides that can be used in hemp production. The review/handbook summarizes the current information and status that may be useful to contribute to the establishment of pest/weed management programs in industrial hemp production in Turkey. Sufficient information on cultural measure (soil tillage, sowing, selection of varieties, fertilization, etc.) which may be needed during the hemp production and fiber processing technology, etc. is available in the literature. However, studies on plant protection in general and weed management in particular are very scarce. This reveals that the information presented in the review may need to be revised in the near future. Since there are important data gaps in the literature regarding on weed and pest management, the data and experiences gained in time can allow to have different perspectives.
Epidemiology of the Hemp Borer, Grapholita delineana Walker (Lepidoptera: Oleuthreutidae), a Pest of Cannabis sativa L.
John M. McPartland
Journal of Industrial Hemp 2002 7:1, 25-42
DOI: 10.1300/J237v07n01_04
The hemp borer, Grapholita delineana, is newly described from feral hemp in Vermont, USA. It may pose a serious pest should hemp cultivation resume in the USA. A similar situation occurred in the 1960s, when G. delineana suddenly became a serious pest in southeastern Europe. Evidence suggests the pest was imported from its native range via infested hemp seed. Larvae of G. delineana bore into stalks and destroy fiber, or they infest flowering tops and destroy seed. The larvae and adults are described, along with their life history, geographic range, and host range. Careful phytosanitary measures can prevent the spread of G. delineana into quarantine areas, such as western Europe, Canada, and the entire southern hemisphere. Breeding hemp plants for resistance to G. delineana may prevent future epidemics. Vermont feral hemp appears to be more resistant to G. delineana than feral hemp growing in the Midwestern USA; the Vermont germplasm may have descended from plants imported in the 1830s, called “Smyrna” hemp, a western European landrace devoid of Chinese ancestry. Biological and chemical controls of G. delineana are described.
Endophytes of industrial hemp (Cannabis sativa L.) cultivars: Identification of culturable bacteria and fungi in leaves, petioles, and seeds
Maryanne Scott, Mamta Rani, Mamta Rani, Jamil Samsatly, Suha Jabaji
June 2018 Canadian Journal of Microbiology 64(10):1-17
DOI: 10.1139/cjm-2018-0108
Plant endophytes are a group of microorganisms that reside asymptomatically within the healthy living tissue. The diversity and molecular and biochemical characterization of industrial hemp-associated endophytes have not been previously studied. This study explored the abundance and diversity of culturable endophytes residing in petioles, leaves, and seeds of three industrial hemp cultivars, and examined their biochemical attributes and antifungal potential. A total of 134 bacterial and 53 fungal strains were isolated from cultivars Anka, CRS-1, and Yvonne. The number of bacterial isolates was similarly distributed among the cultivars, with the majority recovered from petiole tissue. Most fungal strains originated from leaf tissue of cultivar Anka. Molecular and phylogenetic analyses grouped the endophytes into 18 bacterial and 13 fungal taxa, respectively. The most abundant bacterial genera were Pseudomonas, Pantoea, and Bacillus, and the fungal genera were Aureobasidium, Alternaria, and Cochliobolus. The presence of siderophores, cellulase production, and phosphorus solubilization were the main biochemical traits. In proof-of-concept experiments, re-inoculation of tomato roots with some endophytes confirmed their migration to aerial tissues of the plant. Taken together, this study demonstrates that industrial hemp harbours a diversity of microbial endophytes, some of which could be used in growth promotion and (or) in biological control designed experiments.
Endophytic fungi harbored in Cannabis sativa L.: diversity and potential as biocontrol agents against host plant-specific phytopathogens
Parijat Kusari & Souvik Kusari & Michael Spiteller & Oliver Kayser
Fungal Diversity (2013) 60:137–151
DOI 10.1007/s13225-012-0216-3
The objective of the present work was isolation, phylogenetic characterization, and assessment of biocontrol potential of endophytic fungi harbored in various tissues (leaves, twigs, and apical and lateral buds) of the medicinal plant, Cannabis sativa L. A total of 30 different fungal endophytes were isolated from all the plant tissues which were authenticated by molecular identification based on rDNA ITS sequence analysis (ITS1, 5.8S and ITS2 regions). The Menhinick’s index revealed that the buds were immensely rich in fungal species, and Camargo’s index showed the highest tissue-specific fungal dominance for the twigs. The most dominant species was Penicillium copticola that could be isolated from the twigs, leaves, and apical and lateral buds. A detailed calculation of Fisher’s log series index, Shannon diversity index, Simpson’s index, Simpson’s diversity index, and Margalef’s richness revealed moderate overall biodiversity of C. sativa endophytes distributed among its tissues. The fungal endophytes were challenged by two host phytopathogens, Botrytis cinerea and Trichothecium roseum, devising a dual culture antagonistic assay on five different media. We observed 11 distinct types of pathogen inhibition encompassing a variable degree of antagonism (%) on changing the media. This revealed the potential chemodiversity of the isolated fungal endophytes not only as promising resources of biocontrol agents against the known and emerging phytopathogens of Cannabis plants, but also as sustainable resources of biologically active and defensive secondary metabolites.
Not Cannabis specific
Escherichia coli Cells Exposed to Lethal Doses of Electron Beam Irradiation Retain Their Ability to Propagate Bacteriophages and Are Metabolically Active
Front. Microbiol., 10 September 2018
DOI: 10.3389/fmicb.2018.02138
https://www.frontiersin.org/articles...EJ8bOqXDYTcT-0
Reports in the literature suggest that bacteria exposed to lethal doses of ionizing radiation, i.e., electron beams, are unable to replicate yet they remain metabolically active. To investigate this phenomenon further, we electron beam irradiated Escherichia coli cells to a lethal dose and measured their membrane integrity, metabolic activity, ATP levels and overall cellular functionality via bacteriophage infection. We also visualized the DNA double-strand breaks in the cells. We used non-irradiated (live) and heatkilled cells as positive and negative controls, respectively. Our results show that the membrane integrity of E. coli cells is maintained and that the cells remain metabolically active up to 9 days post-irradiation when stored at 4_ C. The ATP levels in lethally irradiated cells are similar to non-irradiated control cells. We also visualized extensive DNA damage within the cells and confirmed their cellular functionality based on their ability to propagate bacteriophages for up to 9 days post-irradiation. Overall, our findings indicate that lethally irradiated E. coli cells resemble live non-irradiated cells more closely than heat-killed (dead) cells.
Not Cannabis specific
Eukaryotic Translation Initiation Factors Shape RNA Viruses Resistance in Plants
Jannat Shopan, Xiaolong Lv, Zhongyuan Hu, Mingfang Zhang, Jinghua Yang
Horticultural Plant Journal (2020)
DOI: 10.1016/j.hpj.2020.03.001
Viruses are representative of a global threat to agricultural production. Genetic resistance is the preferred strategy for the control of viral infection and against loss of crop yield. Viral protein synthesis requires host cellular factors for translating their viral RNAs, and for regulating their replication and cell to cell systemic movement. Therefore, the viruses are dependent on cellular translation factors. Mutations in the gene encoding eIF4E and eIF4G or their isoforms, eIFiso4E, eIFiso4G and eIF2B? have been mapped as a source of plant potyvirus while other genus of plant virus recessive resistance genes in many species are originated from these loci. Some of other plant translation factors, such as eIF3, eIF4A-like helicases, eEF1A and eEF1B, which are required in interacting with viral RNAs and regulating various aspects of the infection cycle, have also been identified. Here, we summarize the mechanisms utilized by RNA viruses of eukaryotic plants and the essential roles of eIFs in virus infection. Moreover, we discuss the potential of eIFs as a target gene in the development of genetic resistance to viruses for crop improvement. This review highlighted newly revealed examples of abnormal translational strategies and provided insights into natural host resistance mechanisms that have been linked to 3’ cap-independent translational enhancer activity.
Evaluating herbicide tolerance of industrial hemp
(Cannabis sativa L.)
January 2020
Crop Science*60(1):419-427
DOI: 10.1002/csc2.20055
Michael L. Flessner Jabari Bryd, Kevin W. Bamber, John H. Fike
Industrial hemp (Cannabis sativa L.) has a wide array of end uses which, when coupled with regulatory reductions in the United States, has spurred renewed interest in its production. Best management practices, including weed control, need to be evaluated. Since little is known about herbicide tolerance of hemp, studies were conducted to identify suitable options for grain or dual?purpose (fiber and grain) production. Greenhouse experiments with pre?emergence and postemergence herbicides were conducted to identify herbicide choices for subsequent field trials. In field studies, S?metolachlor was the safest pre?emergence herbicide, resulting in 0 and ? 15% injury in 2017 and 2018, respectively, and a hemp stand count that was 97% of the nontreated check (pooled across years). All other pre?emergence herbicides tested in the field resulted in ? 25% visible injury in at least one of the years and ? 24% stand reduction relative to the nontreated check (pooled across years). However, no grain yield differences were observed due to pre?emergence herbicides relative to the nontreated check. Postemergence herbicides sethoxydim, quizalofop, bromoxynil, and clopyralid caused < 20% injury across rating timings and years and had similar grain yield as the nontreated check (588 kg ha?1). Our results indicate that S?metolachlor applied pre?emergence or sethoxydim, quizalofop, bromoxynil, and clopyralid applied postemergence are suitable for hemp production, but some of these treatments caused transient visible injury. Future research should be conducted to corroborate results across cultivars, soil types (for pre?emergence herbicides), and environments.
Evaluating the Microbiome of Hemp
Samuel E. Barnett,1 Ali R. Cala,2 Julie L. Hansen,3 Jamie Crawford,3 Donald R. Viands,3 Lawrence B. Smart,4 Christine D. Smart,2,† and Daniel H. Buckley
Phytobiomes Journal • 2020 • 4:351-363
Doi: 10.1094/PBIOMES-06-20-0046-R
Plant microbiomes contribute to plant fitness and crop yields through a variety of mechanisms. Determining variability in microbiome composition among individuals of a species, and identifying core microbiome membership, are essential first steps for exploring host–microbe interactions. Members of a core microbiome are microorganisms that are tightly associated with and are found widespread across individuals of a plant genotype or species. Hemp (Cannabis sativa L.) is an economically important crop that has gained a resurgence following its removal from the list of controlled substances by the U.S. government. Despite renewed interest in this crop, the microbiome of hemp has not been well studied. We analyzed the bacterial and fungal communities associated with four plant compartments (rhizosphere, root tissue, leaf surface, and flowers) of C. sativa ‘Anka’ across six fields in the Finger Lakes region of New York, United States. We found that both bacterial and fungal community composition varied significantly among plant compartments. Rhizosphere communities were largely similar to the bulk soil communities but root tissue, leaf, and flower communities had distinct compositions. We identified candidate core microbiome members of each plant compartment (bacterial core taxa: root tissue [n = 6], leaves [n = 11], and flowers [n = 7]; fungal core taxa: rhizosphere [n = 1], leaves [n = 14], and flowers [n = 2]). Many of these candidate core microbiome members were related to organisms previously associated with plant growth promotion or pathogen resistance in various plants. The core microbiome identified in this study can be further investigated to improve cultivation of this important crop
Evaluation of Biological Insecticides to Control Corn Earworm in Hemp, 2019
Helene Doughty, Kadie Britt, Thomas P Kuhar
Arthropod Management Tests 45(1) January 2020
DOI: 10.1093/amt/tsaa081 https://www.researchgate.net/publica...m_in_Hemp_2019
The objective of this experiment was to assess the efficacy of several biological insecticide products for control of corn earworm (CEW) on grain hemp in Virginia. A field experiment was conducted on planting of ‘Felina 32’ hemp direct seeded with a grain drill at 30 lb. seed per acre on 24 Jun 2019 at the Virginia Tech Eastern Shore Agricultural Research and Extension Center in Painter, VA. The experiment had six treatments: Gemstar (Helicoverpa zea nuclear polyhedrosis virus [HzNPV]), Javelin (Bacillus thuringiensis var. kurstaki), BoteGHA (Beauveria bassiana strain GHA), Entrust (Spinosad), DiPel (Bacillus thuringiensis var. kurstaki), and an untreated check arranged in an RCBD with four replicates. Individual plots were 3 Å~ 10 ft (0.91 Å~ 3.05 m). Hemp plants were sprayed with insecticides in the field using a single-nozzle boom equipped with D3 spray tips powered by a CO2 backpack sprayer at 40 psi. For each treatment, 40.6 fl. oz (1200 ml) was applied to all four replicates, which equates to 58 gallons per acre. All treatments were applied twice with a 7-d interval, except for Gemstar, which was applied three times at 3-d intervals. Treatments were applied on 13 Aug (all treatments), 16 Aug (Gemstar only), 19 Aug (Gemstar only), and 20 Aug (all treatments except Gemstar). On 12 (pre-count), 20, 27 Aug, and 3 Sep, the number of lepidopteran larvae were recorded per inspection of 10 randomly selected plants per plot. On 3 Sep, 10 plants were examined for feeding damage by CEW according to the following rating scale: 0 = no feeding, 1 = some browning/ damage, 2 = advanced browning and feeding damage/holes in seeds, 3 = advanced feeding damage/clipped bud (Table 1). All data were analyzed using ANOVA procedures. Means were separated using Fisher’s LSD at the 0.05 level of significance. CEW was the dominant lepidopteran species observed with an average of 4.2 larvae per 10 plants on 12 Aug (Table 1). Most CEW larvae observed were either second or third instar. Other recorded larvae included yellowstriped armyworm (YSAW) and SMC, but these represented <5% of the total population of lepidopteran larvae. There was a significant treatment effect on CEW counts on 20 Aug with only Entrust resulting in significantly fewer CEW than the untreated check. Although plots treated with Gemstar did not have significantly lower CEW counts, approximately 3–5% of the larvae were diseased with characteristic virus symptoms on 20 and 27 Aug compared with virtually no diseased larvae in the other plots. There was also a significant treatment effect on CEW damage rating, with Entrust resulting in significantly less damage than the untreated check and all other treatments. This is also reflected in the larval count data.
Not Cannabis Specific
Examinations of Fusarium sambucinumon Humulus lupulus and Co-infection with Hop stunt viroid in Commercial Hop Fields
Natasha R. Cerruti THESIS
https://ir.library.oregonstate.edu/c...ions/vq27zs95m
After an unusually high incidence of Fusarium canker was observed in commercial hop fields of the Pacific Northwest, field surveys were conducted and revealed that canker incidence ranged from 20 to 60% of bines sampled in six commercial fields, as well as wide-spread Hop stunt viroid infection in these six fields. A variety of inoculation techniques and incubation conditions were evaluated in laboratory and greenhouse studies to determine whether Fusarium sambucinum incites girdling symptoms on hop bines, which is characteristic of later stage Fusarium canker infection in commercial hop fields. Koch?s postulates were fulfilled, confirming that F. sambucinum incites Fusarium canker and produces girdling, killing the bine. Colonization of detached hop stems with green fluorescent protein-labeled F. sambucinum or F. verticillioides were observed microscopically, but F. sambucinum colonized more aggressively and to a greater extent. Investigation into the effect of relative humidity on colonization of hop stems demonstrated that relative humidities greater than 88% are required for F. sambucinum to colonize green hop stems. Hilling of commercial hop plants was explored as a management strategy to ameliorate canker symptoms or improve yields in commercial fields with wide-spread Hop stunt viroid infection and results indicate that hilling can improve cone yields in commercial hop plantings co-infected with HpSVd and F. sambucinum.
Exploiting Beneficial Pseudomonas spp. for Cannabis Production
Carole Balthazar, David L. Joly and Martin Filion Front. Microbiol. 12:833172.
doi: 10.3389/fmicb.2021.833172 https://www.researchgate.net/publica...ion/references
Among the oldest domesticated crops, cannabis plants (Cannabis sativa L., marijuana and hemp) have been used to produce food, fiber, and drugs for thousands of years. With the ongoing legalization of cannabis in several jurisdictions worldwide, a new high value market is emerging for the supply of marijuana and hemp products. This creates unprecedented challenges to achieve better yields and environmental sustainability, while lowering production costs. In this review, we discuss the opportunities and challenges pertaining to the use of beneficial Pseudomonas spp. bacteria as crop
inoculants to improve productivity. The prevalence and diversity of naturally occurring Pseudomonas strains within the cannabis microbiome is overviewed, followed by their potential mechanisms involved in plant growth promotion and tolerance to abiotic and biotic stresses. Emphasis is placed on specific aspects relevant for hemp and marijuana crops in various production systems. Finally, factors likely to influence inoculant efficacy are provided, along with strategies to identify promising strains, overcome commercialization bottlenecks, and design adapted formulations. This work
aims at supporting the development of the cannabis industry in a sustainable way, by exploiting the many beneficial attributes of Pseudomonas spp.
Expression of Putative Defense Responses in Cannabis Primed by Pseudomonas and/or Bacillus Strains and Infected by Botrytis cinerea
Carole Balthazar, Gabrielle Cantin, Amy Novinscak, David L. Joly and Martin Filion
Front. Plant Sci. 11:572112. 2020
doi: 10.3389/fpls.2020.572112
https://www.frontiersin.org/articles...20.572112/full
Cannabis (Cannabis sativa L.) offers many industrial, agricultural, and medicinal applications, but is commonly threatened by the gray mold disease caused by the fungus Botrytis cinerea. With few effective control measures currently available, the use of beneficial rhizobacteria represents a promising biocontrol avenue for cannabis. To counter disease development, plants rely on a complex network of inducible defense pathways, allowing them to respond locally and systemically to pathogens attacks. In this study, we present the first attempt to control gray mold in cannabis using beneficial rhizobacteria, and the first investigation of cannabis defense responses at the molecular level. Four promising Pseudomonas (LBUM223 and WCS417r) and Bacillus strains (LBUM279 and LBUM979) were applied as single or combined root treatments to cannabis seedlings, which were subsequently infected by B. cinerea. Symptoms were recorded and the expression of eight putative defense genes was monitored in leaves by reverse transcription quantitative polymerase chain reaction. The rhizobacteria did not significantly control gray mold and all infected leaves were necrotic after a week, regardless of the treatment. Similarly, no systemic activation of putative cannabis defense genes was reported, neither triggered by the pathogen nor by the rhizobacteria. However, this work identified five putative defense genes (ERF1, HEL, PAL, PR1, and PR2) that were strongly and sustainably induced locally at B. cinerea’s infection sites, as well as two stably expressed reference genes (TIP41 and APT1) in cannabis. These markers will be useful in future researches exploring cannabis defense pathways
*First Insights Into the Virus and Viroid Communities in Hemp (Cannabis sativa)
Judith Chiginsky, Kaitlyn Langemeier, Jacob MacWilliams, Tessa Albrecht, Whitney Cranshaw, Ana Cristina Fulladolsa, Marylee Kapuscinski, Mark Stenglein and Punya Nachappa
Front. Agron. 3:778433. (Dec 2021)
doi: 10.3389/fagro.2021.778433
Hemp (Cannabis sativa L.) production has increased significantly in recent years; however, the crop has been understudied in the U.S. since its production declined in the late 1950s. Disease identification and management is an increasing challenge for hemp growers across the country. In 2019, beet curly top virus (BCTV) was first reported in hemp in Colorado. Hence, we were motivated to understand the diversity and prevalence of BCTV strains infecting hemp in Colorado. We detected BCTV at high incidence rate (81%) in leaf samples from 12 counties. Two different strains of BCTV, Worland (Wor) and Colorado (CO) were present as a single ormixed infection in hemp leaf samples. Phylogenetic analysis revealed BCTV sequences from hemp formed a distinct group along with BCTV strains CO and Wor. To determine other potential viral and viroid pathogens in hemp, we performed next generation sequencing (NGS). Virome analysis revealed the presence of both virus and viroid sequences that had high nucleotide sequence identity with GenBank accessions for cannabis cryptic virus, cannabis sativa mitovirus, citrus yellow vein associated virus, opuntia-like virus and hop latent viroid. In contrast, tobacco streak virus sequences were highly variable compared to sequences in GenBank suggesting a possible new genotype of this virus. The data presented here has important implications for the epidemiology andmanagement of the various diseases of hemp and will lead to the development of integrated pest management strategies designed to interrupt transmission cycles and facilitate efficient crop production.
First report of anthracnose leaf spot caused by Colletotrichum fioriniae on hemp (Cannabis sativa).
Szarka, D., McCulloch, M. J., Beale, J., Long, S., Dixon, E., & Ward Gauthier, N. A.
(2019). Plant Disease.
doi:10.1094/pdis-10-19-2216-pdn
In August 2018, a field hemp sample with leaf spots was submitted to the University of Kentucky Plant Disease Diagnostic Lab from Jackson County, KY. Leaf spots affected all plants in the field, with spots forming on the lower half of plants in early August as plants entered the reproductive stage. Disease
severity on mature leaves was approximately 20%, and incidence was 100% of plants in the field. All three cultivars in the field were equally affected: ‘Cherry x Cherry,’ ‘Trump 1,’ and ‘Sweetened.’ Symptoms included numerous, scattered, round leaf spots that expanded to necrotic blotches. Spots began as light green specks and developed into round or angular spots with tan centers. Spots were circular but occasionally became irregular as they expanded, reaching 3 to 4 mm in diameter with a darker brown margin and yellow halo. Centers of spots cracked or dropped out, causing shothole or
frog-eye symptoms. Spots sometimes coalesced to form necrotic regions up to 20 mm across. Necrotic areas on or near leaf margins resulted in symptoms typical of anthracnose leaf diseases on other hosts, such as of scorching, puckering, and twisting.
First Report of Beet Curly Top Virus Infecting Industrial Hemp (Cannabis sativa) in Arizona.
Hu, J., Masson, R., & Dickey, L.
Plant Disease.(2020).
doi:10.1094/pdis-11-20-2330-pdn
Industrial hemp (Cannabis sativa) is an emerging crop in Arizona, with many uses, including fiber, cosmetic products, and health food. In 2020, severe curly top disease outbreaks were observed in several hemp fields in Yuma and Graham Counties, Arizona, where disease incidence and severity were considerably high, up to 100% crop loss occurring in some fields. A wide range of symptoms have been observed at different infection stages and plant growth stages at the time of infection. Early stage symptoms manifested as light green-to-yellowing of new growth, similar to sulfur or micronutrient deficiency, usually combined with older leaves with dark green “blotchy” mosaic mottling overlaying light green chlorosis. Mosaic mottling of older leaves continued into mid-growth stage, and was coupled with more severe yellowing and witch’s broom (stunted leaves and shortened internode length of stem) of apical meristematic tissue. Curling and twisting of new leaves had also been observed. Symptoms often appeared to be isolated to individual branches, with other branches showing no visual symptoms, often outgrowing and covering affected branches until harvest. Late stage symptoms included severe leaf curling with or without twisting, continued stunting, and necrosis of yellow leaves, resulting in significant yield reduction. Severely affected plants dwarfed by the virus experienced high mortality rates later into the season, most likely attributed to reduced ability to overcome abiotic stress conditions. These
symptoms indicated the likelihood of curly top caused by Beet curly top virus (BCTV), which has been recently reported in Colorado (Giladi et al., 2020).
First Report of Beet Curly Top Virus Infecting Cannabis sativa L., in Western Colorado.
Giladi, Y., Hadad, L., Luria, N., Cranshaw, W., Lachman, O., & Dombrovsky, A.
Plant Disease. (2019).
doi:10.1094/pdis-08-19-1656-pdn
In industrial hemp (Cannabis sativa L.) fields located in North Fork Valley, Delta County Colorado USA, plants bearing symptoms of stunted growth and yellowing leaves were observed in each growing season between 2015-2019. Infected plants display initially fading leaf color to pale green, starting at the leaf base and expanding towards the tips, producing a yellow-green mosaic pattern (Fig. 1). Within ten days, the symptoms spread to the entire plant. In plants with advanced symptoms, newly developing leaves were pale green, narrower and, curled sideways, leading to a stunted, curled plant. Infection was observed in several different hemp cultivars at different developmental stages, from the vegetative to the flowering stages. To identify the infectious agent, leaves were collected from one symptomatic hemp plant and one non-symptomatic hemp plant on 30 July, 2018 and blotted onto FTA cards (Ndunguru et al. 2005). Nucleic acids extracted from FTA cards and subjected to ribosomal RNA depletion, served for library construction as previously described (Luria et al. 2019) using ScriptSeq™ Complete Kit (Plant Leaf, Illumina, San Diego, CA, USA) and sequenced using Illumina Hiseq 2500, at the Technion Genome Center, Israel. The obtained clean reads were searched for viral sequences using VirusDetect software version 1.7. VirusDetect software involved a pipeline combining de novo assembly with mapping to references of plant viruses from Genbank using Velvet (Zerbino and Birney, 2008). This analysis revealed 31 contigs, which aligned to the entire 2,931 nucleotides of Beet curly top virus (BCTV, Geminiviridae Family, Curtovirus genus), sharing 96.5% and 96.4% identity with the genome sequence of isolates AY134867 and KX867020 detected in B. Vulgaris in 2002 and 2006 respectively. In order to validate the NGS findings, the nucleic acids were used as a template for PCR analysis using several specific primer pairs designed to cover most of the BCTV genome. A selected primer set was used for diagnostics: Forward-337-5'…ATGGGACCTTTCAGAGTGGA…3'; Reverse-1,278- Page 2 of 5 5’…TGTATGCCACATTGTTTGGC…3'. Seven symptomatic hemp plants and three nonsymptomatic plants were tested by PCR using the designed BCTV-specific primers. The PCR products were sequenced by Sanger method (HyLabs, Rehovot, Israel) and assembled, resulting in alignment with the majority of BCTV genomes. Importantly, sequences homologous to BCTV were present only in the leaves of the seven symptomatic hemp plants. The complete HTS-derived viral genome sequence was deposited in GenBank (accession No. MK803280) under the name BCTV-Can. There are several strains of BCTV that infect more than 300 plant species and many agricultural crops including beans, sugar beet, cucumber, peppers, spinach and tomatoes (Strausbaugh and Ejayl 2017). BCTV causes symptoms throughout the western United States and sporadic outbreaks occur in western Colorado, where the symptomatic plants described here were located. The virus is solely transmissible by leafhopper vectors and the only known vector of this pathogen in North America is Neoaliturus (=Circulifer) tenellus (Baker) (Hemiptera: Cicadellidae), known as the beet leafhopper (Bennett 1967). BCTV did not appear in the review of hemp diseases by McPartland et al. (2000) and to the best of our knowledge; this is the first report of BCTV infecting hemp and the first report of any leafhopper-vectored pathogen
First Report of Branched Broomrape (Phelipanche ramosa) on Celeriac (Apium graveolens) in Eastern France
Stéphanie Gibot-Leclerc
Plant Disease 98(9):1286 September 2014
DOI: 10.1094/PDIS-02-14-0148-PDN
Branched broomrape, Phelipanche ramosa (L.) Pomel (syn. Orobanche ramosa L.), is a chlorophyll-lacking, obligate root parasitic plant that infests Brassicaceae, Solanaceae, and legumes (3). In western France, P. ramosa has invaded oilseed rape fields since the 1990s, causing significant yield losses (1). This crop has now become the primary host for the parasite, along with buckwheat (Fagopyrum esculentum L.), hemp (Cannabis sativa L.), and tobacco (Nicotania tabacum L.). In September 2013, a field survey indicated that a celeriac (Apium graveolens L. var. Prinlz) crop on clay soil in the Champagne-Ardennes region
(48°20?19? N, 04°01?57? E, 140 m above sea level, eastern France) was infested with branched broomrape where hemp had been grown 4 years before. The celeriac field was planted to wheat (Triticum aestivum L.) in 2012 in rotation with lentils (Lens culinaris Medik.) in 2011. About 2% of the total celeriac field was infested and the estimated yield losses were approximately 25% for this infested area. The host symptoms observed were a slower growth of celeriac, along with leaf chlorosis, lower fruit production, and numerous abortions. The infestation of the celeriac crop was confirmed by verifying the attachment of branched broomrape to the celeriac roots. Broomrape plant heights were between 4.5 and 21 cm. The stems were erect, branched, frail, rather hairy, and bulging. Scale leaves were limited to 4 to 10 mm long, thick, acuminate, alternate scales. The flowers were numerous (between 4 and 51) and were 8.3 to 14.5 mm long. They were borne in the axils of scaly bracts. They had an irregular, curved shape, and a light mauve color. They did not have distinct peduncles and were grouped in rather long floral scapes during advanced flowering. The corolla tube was 10 to 15 mm long and its restricted part stood higher than the divisions of the calyx. It had ciliate, if not hairy, lobes. The calyx was more or less hairy, zygomorphous, with four lobes, and 6 to 8 mm long. Two bracteoles were situated on either side of the calyx. The four stamens observed were didynamous and borne 4 to 5 mm above the corolla base. The dorsifixed bilocularis, longitudinally dehiscent anthers were glabrous or covered with a fine down along sutures. Georges Sallé, (retired) Professor of Botanics at the University Pierre et Marie Curie, Paris, confirmed the identity of P. ramosa based on morphological characteristics (1). Celeriac infection by branched broomrape was confirmed using a developed assay (2). P. ramosa infecting celeriac roots was described by counting the numbers of individuals having reached ontogenic stages according to Gibot-Leclerc et al. (2). To our knowledge, this is the first study reporting P. ramosa infection on celeriac in eastern France. Since celeriac is produced in rotation with lentils, branched broomrape could pose a serious threat to production of these crops.
First report of 'Candidatus Phytoplasma trifolii' associated with a witches' broom disease in Cannabis sativa in Nevada, USA
X. Feng, M. Kyotani, S. Dubrovsky, and A.-L. Fabritius
Plant Disease Vol. 103, No. 7 July 2019
DOI: 10.1094/PDIS-01-19-0098-PDN
In September 2018, symptoms including leaf curling, mottling, chlorosis, witches’ broom, stunting, and node shortening were detected in Cannabis sativa L. plants at two growing sites in Central and Southern Nevada, U.S.A., respectively. Incidence of the disease varied between 5 and 20% at the growing site in Central Nevada, and 30% of plants were affected at the growing site in Southern Nevada. Symptomatic leaves showed “green islands” that were constrained by the veins on the upper leaf surface, and interveinal discoloration on the lower surface, forming a pale “pustule-like” appearance. One infected plant with 80% of leaves exhibiting symptoms was sampled from the Central Nevada site. One infected plant with 50% of leaves exhibiting symptoms was sampled from the Southern Nevada site. Two nonsymptomatic plants were provided by a local grower in California. Total DNA was extracted from the petioles of the most symptomatic leaves. DNA extracted from nonsymptomatic plants was used as the negative control.
First report of Cercospora cf. flagellaris on industrial hemp (Cannabis sativa) in Kentucky
March 2019 Plant Disease
Vinson P Doyle, Hannah Tonry, Bernadette Amsden, Julie Beale, Ed Dixon, Hua Li, Desiree Szarka, Nicole Gauthier
DOI: 10.1094/PDIS-01-19-0135-PDN
In 2015 and 2016, a leaf spot disease was observed in industrial hemp fields in Kentucky during mid-summer as plant canopies became dense. Leaf spots were first visible on older leaves in the lower canopy, but disease quickly spread throughout the canopy. Early symptoms included small individual yellow flecks on upper sides of leaves. Lesions increased in size but retained a round shape. Centers of lesions turned to tan and then to lighter shades of tan or white with age and reached a maximum of 2-6 mm in diameter with raised dark brown to purplish borders and yellow halos; some spots coalesced as disease progressed. Clusters of melanized conidiophores became visible with the unaided eye in centers of spots before the centers disintegrated
First Report of Cercospora Leaf Spot Caused by Cercospora cf. flagellaris on Industrial Hemp in Florida
M. V. Marin, J. Coburn, J. Desaeger and N. A. Peres
Plant Disease Vol. 104, No. 5 May 2020
DOI: 10.1094/PDIS-11-19-2287-PDN
During a greenhouse (July to September) and a field trial (October to December) in 2019, leaf spots were observed on up to 60% of leaves of hemp plants (Cannabis sativa). Symptoms started on older leaves and eventually spread throughout the canopy. Infections began with small yellow, individual flecks. Lesions developed to turn light tan, or even white, with yellow halos and fascicles of conidiophores were visible to naked eye at the center. Severely infected leaves usually developed chlorosis (yellowing), which lead to premature defoliation. Diseased leaves were surface sterilized with 10% bleach solution for 90 seconds and isolation was performed on General Isolation (GI) medium (Forcelini et al. 2016). Resulting colonies were whitish to gray after incubation in a growth chamber at 25°C, 12/12 photoperiod. Isolates were single- spored and resulting colonies were transferred to carrot-agar (CA) and PDA+6% sucrose where they appeared brown- to- dark color due to sporulation (Figure 1) (Leslie and Summerell 2006).
First Report of Chaetomium globosum Causing a Leaf Spot of Hemp (Cannabis sativa) in Tennessee
A. G. Chaffin, M. E. Dee, S. L. Boggess, R. N. Trigiano, E. C. Bernard, and K. D. Gwinn
Plant Disease Vol. 104, No. 5 May 2020
DOI: 10.1094/PDIS-08-19-1697-PDN
Cultivation of hemp (Cannabis sativa), a crop grown for food, fiber, biofuel, and natural medicine worldwide, has increased in the southeastern United States. Pilot and research programs were legalized in 2014, and hemp was removed from the list of Schedule I controlled substances in 2018 (Agriculture Improvement Act of 2018; Mead 2019). Little is known about hemp pathogens, but pathogens of marijuana strains grown in controlled environments were recently described (Punja et al. 2019). Symptomatic plants were found in the North Greenhouse at the University of Tennessee, Knoxville, TN, in September 2017. Leaf spots began as chlorotic lesions near the margins and progressed to necrotic lesions with chlorotic halos. Leaves with chlorotic and necrotic lesions were collected from three 4-month-old plants of two fiber hemp cultivars, Fedora 17 and Futura 75.
First Report of Charcoal Rot Caused by Macrophomina phaseolina on Hemp (Cannabis sativa L.) Varieties Cultivated in Southern Spain
S. Casano, A. Hern.ndez Cotan and M. Mar.n Delgado,
Plant Disease 102(8), 1665
DOI: 10.1094/PDIS-02-18-0208-PDN
In June 2015 and July 2016 charcoal rot symptoms were observed in plants of different industrial and medicinal hemp varieties grown in two different fields located in Southern Spain (Los Chapatales and Alcal. del R.o, Seville). In Los Chapatales, disease incidence was 22% in variety Futura 75. In Alcal. del R.o, the medicinal hemp varieties Sara and Aida (disease incidence: 25.5% and 37.1%, respectively) were more susceptible than varieties Theresa (3.8%), Pilar (3.2%), and Juani (2.7%). In both fields, affected plants developed a systemic chlorosis, rapidly wilted, showed necrosis and died. Before the stalk was completely desiccated, internal tissues appeared soft and fluffy. Discoloration of the stalk was detected near the soil line where small black sclerotia were observed. Roots were necrotic with areas of brown-violet color of unprotected vascular cambium.
First Report of Curvularia pseudobrachyspora Causing Leaf Spot on Hemp ( Cannabis sativa ) in Florida
M. V. Marin, N.-Y. Wang, J. Coburn, J. Desaeger and N. A. Peres
Plant Disease October 7 2020
https://apsjournals.apsnet.org/doi/f...03-20-0546-PDN
DOI: 10.1094/PDIS-03-20-0546-PDN
Hemp (Cannabis sativa L.) is an emerging crop in Florida, with potential use in a variety of commercial and industrial products, including rope, textiles, bioplastics, and insulation. During a field trial in 2019 (October to December) in Wimauma, FL, leaf spots were observed on up to 70% of one-month-old hemp plants on several varieties, such as 'Pumma-2', 'Eletta Campana', 'Carmagnola Selezionata', and 'Tygra' with up to 50% leaf damage in the field. Symptoms started on young and old leaves with small yellow spots that eventually turned tan to brown with a yellow halo. Pieces of diseased leaf tissue were surface sterilized with a 10% bleach solution for 90 s, rinsed twice with sterile deionized water, and then placed on General Isolation medium (Forcelini et al. 2016). The plates were kept in a growth chamber at 25°C under a 12/12 photoperiod. Fungal colonies with sparse aerial mycelium, fimbriate margins, and pale light gray zones or alternate gray olivaceous-to-brown zones on the surface were consistently isolated and single-spored. Four isolates were selected for identification and pathogenicity tests.
First Report of Crown and Root Rot Caused by Pythium aphanidermatum on Industrial Hemp (Cannabis sativa) in Arizona
Jiahuai Hu and Robert Masson
Plant Disease March 2021
https://apsjournals.apsnet.org/doi/p...01-21-0065-PDN
During July and August 2020, symptoms of leaf yellowing and browning, sudden wilting, and death were observed on industrial hemp plants (Cannabis sativa L.) in several drip-irrigated fields in Yuma and Graham county, Arizona. About 85% of plants showed severe crown and root rot symptoms. A high percentage of affected plants collapsed under intensive heat stress. Shriveled stem tissue with necrotic lesions can often be seen at the base of the plant, extending upwards more than 5 cm. Internal tissue of main stem and branches was darkened or pinkish brown. Outer cortex of root bark was often completely rotten, exposing the white core. Cottony aerial mycelium was visible on the surface of stalk of some of
the infected plants in two fields in Yuma. To identify the causal agent, a total of twenty symptomatic plants were collected from several fields across the state. Crown and root tissues from affected plants were harvested and rinsed in tap water to remove soils.
First Report of Crown and Root Rot Caused by Pythium myriotylum on Hemp (Cannabis sativa) in Arizona
Jiahuai Hu
Plant Disease 2021
https://apsjournals.apsnet.org/doi/p...12-20-2712-PDN
During August and September 2020, symptoms of leaf chlorosis, stunting, and wilting were observed on
indoor hemp plants (Cannabis sativa L. cv. ‘Wedding Cake’) in a commercial indoor facility located in
Coolidge, Arizona. Plants were grown in soilless coconut coir growing medium (Worm Factory
COIR250G10), watered with 1.5 to 2.1 liters every 24 h through drip irrigation, and supplemented with
18 h of lighting. About 35% of plants displayed symptoms as described above and many symptomatic
plants collapsed. To identify the causal agent, crown and root tissues from four symptomatic plants were
harvested and rinsed with tap water. Tissue fragments (approx. 2 to 4 mm in size) were excised from the
margins of the stem and root lesions, surface sterilized in 0.6% sodium hypochlorite for 1 min, rinsed
well in sterile distilled water, blotted dry, and plated on potato dextrose agar (PDA) and on oomyceteselective
clarified V8 media containing pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene
(PARP). Plates were incubated at room temperature (21-24 oC). Five isolates resembling Pythium were
transferred after 3 days and maintained on clarified V8 media. Morphological characteristics were
observed on grass blade cultures (Waterhouse 1967). Grass blades were placed on CV8 inoculated with
the isolate. After a 1-day incubation at 25°C, the colonized blades were transferred to 8 ml of soil water
extract in a Petri dish.
First Report of Diaporthe phaseolorum Causing Stem Canker of Hemp (Cannabis sativa)
M. V. Marin, N.-Y. Wang, J. D. Coburn, J. Desaeger and N. A. Peres
Plant Disease (2021)
https://apsjournals.apsnet.org/doi/p...06-20-1174-PDN
Hemp is an annual herbaceous plant that is used for its fiber and oil in a variety of commercial and industrial products. In Florida, it is currently being explored as a new specialty crop. During a field trial from October to January 2019 in Wimauma, FL, a stem canker was observed on up to 60% of three-month-old plants of 'Eletta Campana', 'Carmagnola Selezionata', and 'Tygra'. Symptoms started on the main stems with light-to-dark brown lesions of different sizes and shapes. Over time, the lesions coalesced into large necrotic areas and bore pycnidia. Isolations were made from diseased stem tissues on General Isolation medium (Amiri et al. 2018) after surface disinfestation (Marin et al. 2020). The plates were placed in a growth chamber at 25°C under a 12/12 photoperiod. A fungus with white, floccose, aerial mycelium and pycnidia producing alpha and beta conidia was consistently isolated. Three single spore isolates were chosen for identification and pathogenicity tests.
First Report of Exserohilum rostratum Causing Foliar Blight of Industrial Hemp (Cannabis sativa L.)
Lindsey Thiessen, Tyler Schappe
January 2019 Plant Disease
DOI: 10.1094/PDIS-08-18-1434-PDN
In the 2017 and 2018 growing seasons (between May and October), industrial hemp plants of several cultivars including those grown for fiber, seed, and flower from numerous counties in North Carolina showed foliar, stem, and floral blight symptoms. Plants were collected from samples submitted to the North Carolina State University Plant Disease and Insect Clinic. Lesions on leaves were round, brown to black, with dark margins. Inside of each lesion, abundant conidia were found. Conidia were rostrate, ellipsoidal to narrowly obclavate, straight or slightly curved, olive-brown, with a protuberant, cylindrical hilum at the base. Conidia were 7 to 12 septate and 75.64±8.31× 15.61±1.41 µm. Conidiophores were cylindrical, olivaceous-brown with swollen conidiogenous cells containing circular conidial scars. Isolates were obtained by transferring single spores to water agar and then transferring to potato dextrose agar.
First Report of Fusarium falciforme (FSSC 3+4) Causing Rot of Industrial 2 Hemp (Cannabis sativa) in California.
K. R. Paugh, J. Del Castillo Múnera, and C. L. Swett
https://apsjournals.apsnet.org/doi/p...08-21-1640-PDN
Industrial hemp (Cannabis sativa) is a newly legal crop in California that is grown for cannabidiol oil, fiber and seed. In August 2019, whole plant decline and root rot were observed affecting <5% of plants in two industrial fields in Fresno County, CA. Symptoms included chlorotic, collapsed foliage, stem vascular discoloration, and root rot with abundant mycelial growth. Stem and root segments (1-2 cm) from three to five diseased plants were agitated in 0.1% tween-20 and soaked in 70% ethanol for 30 s and 1% NaOCl for 2 min. After incubating for 5 to 7 days on 1:10 potato dextrose agar (PDA) amended with tetracycline, Fusarium selective medium (FSM), and PARP (pimaricin + ampicillin + rifampicin + pentachloronitrobenzene [PCNB] agar) medium, white to pale cream aerial mycelium emerged from tissue of all plants on PDA and FSM but not PARP. Isolates cultured on 0.1% potassium chloride agar formed heads of microconidia on long monophialides consistent with the Fusarium solani species complex (FSSC) (Leslie and Summerell 2008). To obtain pure cultures of two isolates (CS529 and CS530), a single-hyphal tip was excised and grown on PDA. FSSC was described as causing foot rot in hemp in Italy (Sorrentino et al. 2019), but these isolates belonged to phylogenetic species 5 (F. solani) not F. falciforme. In addition, F. falciforme was reported as causing root rot in hydroponically grown cannabis (Punja and Rodriguez 2018). These studies provide the foundation for development of management tools for hemp disease.
First Report of Fusarium graminearum Causing Flower Blight On Hemp (Cannabis sativa) in Kentucky
Gabdiel E. Yulfo-Soto, Henry Smith, Desiree Szarka, Ed Dixon, Lisa J. Vaillancourt, Nicole Gauthier
Plant Disease 2021 july
https://apsjournals.apsnet.org/doi/p...06-21-1292-PDN
In October of 2020, a grower in Boyle County, KY, reported mold and blight symptoms on flowers of field-grown hemp. Plants were approaching harvest, and the mold was affecting 100% of the cultivar ‘White CBG’ being grown for cannabinoid (CBD) extraction. Mycelium colonized the flower heads and any seeds within bracts. Affected flower bracts were necrotic, and mycelium and necrosis in the most severe cases also encompassed adjacent (sugar) leaves. Necrotic symptomatic tissue was collected, disinfested in 10% bleach for one minute, and cultured on acidified potato dextrose agar (APDA). Each isolate was single-spored, transferred to PDA, stored in 15% glycerol at -80°C and maintained at room temperature under blacklight blue and fluorescent bulbs on a 12-hour light-dark cycle. Colonies produced white-pink mycelia with a dark red pigment on the undersides. Conidia collected after 7-9 days were falcate and septate (5 to 6). No microconidia were produced. Macroconidia measured 35.4-49.7 µm x 3.4-22 5.8 µm (n=50).
First report of Powdery Mildew Caused by Golovinomyces ambrosiae on Cannabis sativa in Oregon
Michele S. Wiseman, Taylor A. Bates, Andrea R. Garfinkel, Cynthia M. Ocamb, David. H. Gent
Plant Dis. 2021 Feb 2.
doi: 10.1094/PDIS-11-20-2455-PDN
https://apsjournals.apsnet.org/doi/p...11-20-2455-PDN
Oregon is the second largest producer of hemp in the United States with 25,900 ha of hemp licensed to growers in 2019, a nearly six-fold increase over the previous year (Perkowski 2019, Capital Press). Industrial hemp has a wide range of uses including textiles to nutritional supplements; in Oregon, hemp has become one of the most economically promising crops and is mainly cultivated for cannabidiol (CBD) production. Between 2018 and 2019, multiple independent greenhouse growers in western Oregon reported powdery mildew-like signs and symptoms on leaves and buds of several Cannabis sativa cultivars, including ‘Cherry Wine’
First report of Fusarium proliferatum causing crown and stem rot, and pith necrosis, in cannabis (Cannabis sativa L., marijuana) plants
Zamir K. Punja
Canadian Journal of Plant Pathology 2021 Vol. 43, No. 2, 236–255,
DOI: 10.1080/07060661.2020.1793222
https://www.tandfonline.com/doi/pdf/...eedAccess=true
Cannabis (Cannabis sativa L., marijuana) plants grown under greenhouse or controlled environments with symptoms of leaf yellowing, leaf necrosis and defoliation were observed during 2018–2019. Additional symptoms included crown rot and internal browning or blackening of the pith tissues. Stock (mother) plants as well as plants in the vegetative and flowering stages of 15 cannabis strains (genotypes) were affected. In addition, damping-off symptoms were observed on rooted cuttings in propagation rooms. Isolations from diseased tissues yielded predominantly Fusarium proliferatum, with some F. oxysporum also recovered. Phylogenetic analysis of sequences from the translation elongation factor 1α (TEF-1 α) region of 29 isolates of F. proliferatum from eight licenced production facilities in three provinces in Canada (British Columbia, Ontario and New Brunswick), and one cannabis production site in northern California, grouped isolates from cannabis with a large clade of isolates from a wide range of other hosts in different geographic regions. Pathogenicity studies confirmed the ability of F. proliferatum to cause symptoms of wilting, leaf and pith necrosis, and plant death on cuttings, rooted plants and stock plants. Inoculated tomato and cucumber plants developed similar symptoms. Stem colonization was more extensive by F. proliferatum compared to F. oxysporum on cannabis cuttings. Both grew optimally at 25°C on agar media although F. oxysporum grew faster than F. proliferatum at all temperatures tested. The occurrence of F. proliferatum on cannabis plants has not been previously reported, adding to recent reports of F. oxysporum
First report of Golovinomyces cichoracearum sensu lato on Cannabis sativa in Israel
M. Maymon, S. Jerushalmi and S. Freeman
New Disease Reports 42, 11.
DOI: 10.5197/j.2044-0588.2020.042.011
https://bsppjournals.onlinelibrary.w.. .8.2020.042.011
In recent years, the use of cannabis (Cannabis sativa) has gained popularity for medical and other purposes, and its cultivation worldwide has expanded rapidly (Ruchlemer et al., 2015; Jerushalmi et al., 2020).
During April 2020, symptoms of powdery mildew were observed on commercially cultivated medical cannabis in the greenhouses of several farms in Israel, causing serious concerns, since affected material was discarded, deemed unfit for medical consumption. Symptoms initially appeared as small, white circular patches of epiphytic mycelia with conidia on the upper sides of mature leaf surfaces, similar to those described by Pépin et al. (2018). As the disease progressed, colonies expanded in size, coalescing and covering entire leaf surfaces, succulent stems and inflorescences (Fig. 1). Conidia were produced in chains on conidiophores that were single and erect, unbranched and cylindrical, arising from the colonies (Fig. 2). The conidia were hyaline, cylindrical to ellipsoid in shape, measuring 38.8-45.4 µm in length and 15.9-21.1 µm in width (Fig. 3). No chasmothecia were observed.
The pathogen was identified by molecular analyses and sequencing of the internal transcribed spacer (ITS) region of rDNA following amplification by PCR using ITS1 and ITS4 primers. Sequences were deposited in GenBank (Accession Nos. MT791387- MT791389), and BLAST analyses revealed 100% identity to Golovinomyces cichoracearum sensu lato, as recently reported from cannabis plants in Canada (Pépin et al., 2018). Due to its complex taxonomy, G. cichoracearum is considered a species complex, composed of specialised as well as less specialised races, taxa or even cryptic species.
First report of Golovinomyces spadiceus causing powdery mildew on industrial hemp (Cannabis sativa L.) in Ohio.
Farinas, C., & Peduto Hand, F.
Plant Disease. (2020).
doi:10.1094/pdis-01-20-0198-pdn
Industrial hemp cultivation is highly valued in North America for oilseed production as well as cannabidiol (CBD), which are considered having many therapeutic qualities (Cherney et al. 2016). The 2018 Farm Bill’s decriminalization of hemp has expanded the ability of states to cultivate and process hemp and transfer hemp-derived products across state lines, paving the way to new business opportunities for US farmers. At the same time, it has incentivized
universities across the nation to engage in hemp research and provide extension services to farmers. In August 2019, patches of white powdery fungal growth typical of powdery mildew were observed covering the older leaves of two-month old plants of Cannabis sativa cv. Tangerine maintained in the research greenhouse of the Department of Plant Pathology at the Ohio State University in Columbus, OH. Approximately 80% of the plants within the greenhouse were affected.
First Report of Hemp Canker Caused by Sclerotinia sclerotiorum in Alberta, Canada
P. S. Bains, H. S. Bennypaul, S. F. Blade, and C. Weeks
Plant Disease Vol. 84, No. 3 March 2000
DOI: 10.1094/PDIS.2000.84.3.372B
Hemp (Cannabis sativa L.) is a herbaceous annual grown mainly for its blast fiber and seed oil. In 1999, Health Canada issued licenses to plant 12,145 ha of hemp in Canada. Of these, 730 ha were in Alberta. During the last week of August, hemp plants (cv. Fasamo) in a central Alberta field showed the following symptoms and signs: wilting foliage turning light brown; dry tan to gray lesions on stems; shredding and breaking of stems at the lesion; presence of white mycelium in the lesion; and black round, irregular, or oblong sclerotia (up to 5 mm diameter and 2 to 11 mm long) present externally at the lesion on the stem and inside the pith cavity. Lesions were found at the crown, near the inflorescence, and along the entire stem length. Disease incidence in a survey of six commercial fields (40 ha) ranged from 1 to 8%. The organism isolated from lesions on potato dextrose agar produced white aerial mycelia and large numbers of sclerotia characteristic of Sclerotinia sclerotiorum. Pathogenicity was confirmed by inoculating 23-day-old greenhouse-grown hemp plants (cv. Fasamo) with autoclaved wheat grains colonized for 14 days with a S. sclerotiorum culture previously isolated from an infected hemp plant. The grains were placed on soilless growing medium near the plant and covered very lightly. One week after inoculation, grayish lesions appeared on the stems, white mycelia appeared on lesions, and plants wilted. The pathogen was reisolated from the lesions. This is the first report of S. sclerotiorum on hemp in Alberta, Canada. The disease known as hemp canker has been reported to cause severe losses under cool wet conditions in the Netherlands
First Report of Hemp Leaf Spot Caused by a Bipolaris Species on Hemp (Cannabis sativa) in Kentucky.
Szarka, D., Amsden, B., Beale, J., Dixon, E., Schardl, C. L., & Gauthier, N.
Plant Health Progress, 82–84.(2020).
doi:10.1094/php-01-20-0004-br
First Report of Hemp Leaf Spot Caused by a Bipolaris Species on Hemp (Cannabis sativa) in Kentucky
Upon reintroduction of hemp (Cannabis sativa) in 2014, reports of a leaf spot disease became increasingly common in Kentucky. Outdoor-grown plants became severely affected with necrosis and blight symptoms, and many crops were rejected by processors either as a result of leaf and bud necrosis or as a result of reduced levels of cannabidiol. Morphological data and sequences of ITS and partial 28S rDNA identified the pathogen as Drechslera gigantea. Phylogenetic analysis grouped all isolates in a clade within Bipolaris. Dicot and monocot weed hosts within symptomatic fields were also identified. We refer to the disease as Bipolaris leaf spot, but the common reference is hemp leaf spot. This is the first report of a Bipolaris pathogen infecting C. sativa. Widespread distribution, disease severity, and extreme yield losses makes this one of the most important diseases of hemp in Kentucky.
First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.
Ren, Z., Chen, X., Luan, M., Guo, B., & Song, Z.
Plant Disease. (2020).
doi:10.1094/pdis-07-20-1451-pdn
Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24–48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines.
First report of Meloidogyne incognita infecting Cannabis sativa in Alabama
Bisho R. Lawaju, William Groover, Jessica Kelton, Kassie Conner, Edward Sikora and Kathy S. Lawrence
JOURNAL OF NEMATOLOGY e2021-52 | Vol. 53
DOI: 10.21307/jofnem-2021-052
https://www.ncbi.nlm.nih.gov/pmc/art...nem-53-052.pdf
Hemp (Cannabis sativa L.) is a new crop in Alabama. In 2019, symptomatic plants with stunted growth, poor root development, and numerous galls were observed in hemp plants grown in Geneva County, AL. After harvest, soil samples were collected from areas with the symptomatic plants and root-knot nematode (Meloidogyne spp.) were found in the soil. Based on morphological features and the polymerase chain reactions using species-specific primers, it was identified as Meloidogyne incognita. Further, a host differential test in a greenhouse assay confirmed it to be M. incognita race 3. The pathogenicity of the nematode to the hemp was confirmed by a modified version of Koch’s postulates. To our knowledge, this is the first report of M. incognita infecting Cannabis sativa in Alabama.
First Report of Meloidogyne javanica Infecting Hemp (Cannabis sativa) in China.
Song, Z. Q., Cheng, F. X., Zhang, D. Y., Liu, Y., & Chen, X. W.
Plant Disease, 101(5), 842. (2017).
doi:10.1094/pdis-10-16-1537-pdn
Hemp (Cannabis sativa L.) is an important annual herbaceous plant for its bast fiber, seed oil and psychoactive substances. In China, hemp cultivation has more than 6000 years of history, and planting area of seed hemp and fiber hemp accounted for 40-50% of the world total in the last decade (Amaducci et al. 2015). The root-knot nematode Meloidogyne javanica can infect hemp cultivars in South Africa (Pofu and Mashela 2014), but damage to this plant caused by M. javanica has notbeen reported in China until now.
First report of Neofusicoccum parvum causing dieback and canker disease on hemp in the United States
C. Feng, M. I. Villarroel-Zeballos, P. F. Ficheux, H. Zima, B. D.S. Dhillon, J. C. Correll
Plant DiseaseVol. 104, No. 11 November 2020
Doi: 10.1094/PDIS-03-20-0486-PDN
Hemp (Cannabis sativa L.) had been grown as a fiber crop in the U. S. for over 300 years prior to it being banned as schedule 1 drug in 1970 (Small and Marcus 2002). After the farm bill legislation in 2018, hemp was reintroduced as a crop into Arkansas where approximately 700 ha were grown in 2019. In July, on a single farm in Searcy Co., AR, one to two-month old hemp plants (cultivars: Trump and Cherry Wine) were observed with leaf discoloration and curling, and branch dieback with distinct lesion margins on the stem. The dieback was predominantly on the main terminal. Approximately 10% of the plants were observed with dieback symptoms. The infected branches and the whole plants with terminal infections often would die, significantly impacting yield. Small pieces from symptomatic stems and leaves of the field samples were surface sterilized in 10% bleach for one minute, washed in sterile deionized water three times, and then placed on water agar (WA). After three days, mycelia growing out from both leaf and stem tissue was transferred onto potato dextrose agar (PDA) to recover pure cultures. Seventeen isolates recovered from eight separate plants had an identical colony morphology. Seven-day old colonies developed grey aerial mycelia, but no conidia. However, pycnidia, containing a large number of both septate and nonseptate conidia, were found on the WA surface after seven days, or on symptomatic plant tissue incubated in a moist chamber for 48 h. The average size of conidia (n=20) was 22.9±1.6 µM long by 12.8±1.1 µM wide.
First Report of Powdery Mildew Caused by Golovinomyces spadiceus on Industrial Hemp ( Cannabis sativa ) in Kentucky
Desiree Szarka, Lydia Tymon, Bernadette Amsden, Nicole Gauthier, Ed Dixon, Justin Kirk Judy
February 2019 Plant Disease
DOI: 10.1094/PDIS-01-19-0049-PDN
Industrial hemp (Cannabis sativa) was reintroduced to the United States as a pilot research program under the 2014 Farm Bill. By 2017, there were over 25,000 acres of industrial hemp in the United States, with Kentucky having the second highest acreage in the United States (https://www.votehemp.com/resources/publications/). Hemp is processed for fiber (4%), grain/seed (18%), and cannabidiol (CBD, 62%), and grosses $7.5M for Kentucky growers. Between 2014 and 2018, powdery mildew was observed in numerous greenhouses, in multiple locations, and on several varieties including but not limited to Cherry Wine, Endurance, Otto, proprietary CBD varieties, and fiber and grain breeding lines. Symptoms initially appeared as small, inconspicuous white patches on the adaxial side of leaves. Colonies expanded in size, often coalescing and infecting entire leaves and succulent stems. The disease spread readily to asymptomatic plants. Pathogenicity of three isolates collected from hemp specimens was confirmed through touch inoculation where conidia from infected leaves were pressed onto asymptomatic leaves. Inoculated plants were moist chambered for 48 h and maintained in the greenhouse. Symptoms appeared within 6 to 7 days, and morphological features were identical to the original; noninoculated control plants did not develop symptoms. Mycelia were amphigenous and occasionally caulicolous; hyphae were septate with septations 5 to 6 µm apart. Foot cells were cylindrical, measuring (42 to) 57 to 107 (to 120) µm × 9 to 11 µm, followed by one to two shorter cells. Conidiophores were hyaline, singular, and erect, measuring (80 to) 115 to 187 (to 209) µm in length, followed by two to three immature conidia forming a crenate outline. Conidia were catenescent and ellipsoid to ovoid, measuring (29 to) 30 to 39 (to 41) µm × (13 to) 15 to 20 (to 22) µm. Chasmothecia readily formed during autumn, were round and dark brown at maturity, measured (96 to) 109 to 138 (to 159) µm in diameter, and displayed nondescript myceloid appendages. Mature chasmothecia contained five to 15 ovoid-saccate asci, most with short stalks. Asci measured (52 to) 56 to 75 (to 78) µm × (25 to) 29 to 43 (to 50) µm, and each ascus contained two ovoid ascospores measuring (15 to) 18 to 27 (to 32) × (9 to) 11 to 18 (to 19) µm. Morphological characteristics were consistent with descriptions of Golovinomyces spadiceus except that foot cells from these isolates had a wider range of lengths compared with previous reports, 30 to 80 × 9 to 15 µm versus 42 to 116 × 9 to 11 µm (Braun and Cook 2012). Conidial measurements were similar but not identical to G. ambrosiae, which is reported to have a longer conidial length/width ratio (2.0) than G. spadiceus (1.5 to 2.0); these isolates had conidial length/width ratios consistent with G. spadiceus (Braun and Cook 2012). Identification was confirmed by sequencing the 28S and internal transcribed spacer (ITS) regions with primers PM5G/NLP2 for the 3? half of ITS and 28S and ITS5/PM6G for the 5? half of ITS (Bradshaw et al. 2017). Sequence data were deposited into GenBank (MK305282). A GenBank BLAST search resulted in a 100% similarity to G. spadiceus (GenBank accession AB769427) and 97% similarity to G. asterum, G. orontii, and G. cichoracearum. The latter species were eliminated based on strong inconsistences in morphological comparisons. This species was determined to be G. spadiceus based on morphological features and sequence data. This determination is consistent with those of powdery mildew fungi collected from Cannabis in Canada (Pépin et al. 2018). All samples collected during this period were consistent; no other powdery mildew species was identified. This is the first documented report of G. spadiceus causing powdery mildew on hemp in the United States. With recent legalization of hemp in the United States, it is important to document the species and distribution of powdery mildew fungi affecting this crop.
First report of Powdery Mildew Caused by Golovinomyces ambrosiae on Cannabis sativa in Oregon
Michele S. Wiseman, Taylor A. Bates, Andrea R. Garfinkel, Cynthia M. Ocamb, David. H. Gent
Plant Disease (2021)
https://apsjournals.apsnet.org/doi/p...11-20-2455-PDN
Oregon is the second largest producer of hemp in the United States with 25,900 ha of hemp licensed to growers in 2019, a nearly six-fold increase over the previous year (Perkowski 2019, Capital Press). Industrial hemp has a wide range of uses including textiles to nutritional supplements; in Oregon, hemp has become one of the most economically promising crops and is mainly cultivated for cannabidiol (CBD) production. Between 2018 and 2019, multiple independent greenhouse growers in western Oregon reported powdery mildew-like signs and symptoms on leaves and buds of several Cannabis sativa cultivars, including ‘Cherry Wine’.
First Report of Pythium aphanidermatum Crown and Root Rot of Industrial Hemp in the United States
Janna L. Beckerman, Hannah Nisonson, Nicolette Albright, Tom C. Creswell
February 2017 Plant Disease 101(6)
DOI: 10.1094/PDIS-09-16-1249-PDN
During June and July 2015, crown and root rot symptoms were observed on industrial hemp (Cannabis sativa cv. Alyssa and cv. Canda), in research plots in Lafayette, IN. Record setting rainfall in Indiana during June (218.4 mm) and July (162.6 mm), may have factored into this outbreak. Soil type is Crosby-Miami complex alfisol. Symptom development appeared 13 days after sowing with temperatures ranging from 25 to 30°C. Leaves of affected plants were chlorotic, and plants were stunted and often wilted. Brown lesions on roots, and loss of feeder roots were observed when symptomatic plants were removed from soil; symptomatic plants often but not always possessed brown, water-soaked stem lesions. A small percentage of affected plants collapsed, but most persisted in stunted growth. Thin, aerial mycelia were visible on the stem surface of some of the infected plants.
First report of Pythium ultimum causing crown rot in greenhouse grown Cannabis sativa (L.) in California.
Pitman, T. L., Philbrook, R. N., Vetterli, M. R., & Warren, J. G.
Plant Disease. (2020).
doi:10.1094/pdis-10-20-2228-pdn
In April of 2020 cuttings of Cannabis sativa (L.) in a greenhouse in San Mateo County, CA were observed collapsing, and further observation revealed: water-soaked stems, tan discoloration to the cortex, and discolored roots. The greenhouse irrigation system was supplied by a local stream. We collected one liter water samples from: intake pond, reservoir tank, irrigation lines, and local potable water tap. Water samples were filtered and plated as described previously (Rollins et al., 2016). Filter papers were removed after 24 hours. Crown sections from four symptomatic plants and one asymptomatic plant were surfaced sterilized in 10% bleach for five minutes, rinsed in sterile deionized water, cut into fourmillimeter long sections, and plated onto V8 media, then incubated at room temperature for three days. White mycelial growth was observed from foci within the print of the filter paper from all irrigation water samples but not the potable water supply sample. Similar mycelial growth was observed from plated crown tissue from symptomatic plants only. Observation under light microscope revealed characteristics congruent with P. ultimum, including aseptate hyphae and globose sporangia (Watanabe, 2002).
First Report of Pythium ultimum Crown and Root Rot of Industrial Hemp in the United States
Plant Disease
Janna L. Beckerman, Jessica Stone, Gail E. Ruhl, Tom C. Creswell
Plant Disease Apr 2018
DOI: 10.1094/PDIS-12-17-1999-PDN
During June 2016, root rot symptoms were observed on industrial hemp (Cannabis sativacv. ‘Canda’), in research plots in Lafayette, IN. Rainfall in Indiana during June (127.8 mm) of 2016 was similar to previous averages of 116.1, although a severe rainfall event on 4 June (47.2 mm), 2 days after planting, resulted in physical crusting of the soil surface. Symptom development first appeared 14 days after sowing with temperatures ranging from 25 to 30°C. Affected plants were stunted with chlorotic leaves. Most of the symptomatic plants simply persisted in stunted growth. A sampling of 12 symptomatic plants was removed from the soil, and brown, water-soaked root lesions were observed. Plants were rinsed in tap water to remove soil debris and then 1 to 2 in. was clipped from the bottom of each seedling root to use on Pythium selective medium.
First Report of Root Rot and Wilt Caused by Pythium myriotylum on Hemp (Cannabis sativa) in the United States
C. S. McGehee, P. Apicella, R. Raudales, G. Berkowitz, Y. Ma, S. Durocher and J. Lubell
Plant Disease Vol. 103, No. 12 December 2019
DOI: 10.1094/PDIS-11-18-2028-PDN
In September 2018, a hemp plant (Cannabis sativa L. cv. Dinamed) presented severe wilting, root rot, and mortality in a research greenhouse at the University of Connecticut in Storrs, CT. The hemp plant was grown in a 11.36-liter container with soilless peat-based potting mix (SunGro Fafard 3B, Agawam, MA, U.S.A.). The plants were in a polycarbonate greenhouse with a daytime heating set point of 20°C and a ventilation set point of 26°C under 18 h of supplemental lighting. Roots were collected from the symptomatic hemp plant, washed three times with sterile deionized water, blotted dry, and plated on PARP selective medium (Jeffers and Martin 1986). The plates were incubated in the dark at 21°C for 48 h. Mycelia resembling the morphology of Pythium species were observed in all plates.
First Report of Serratia marcescens Causing a Leaf Spot Disease on Industrial Hemp (Cannabis sativa L.).
Schappe, T. L., Thiessen, L., Ritchie, D. F., & Thiessen, L. D.
Plant Disease. (2019).
doi:10.1094/pdis-04-19-0782-pdn
In the 2017 and 2018 growing seasons (between May and October), several cultivars of industrial hemp plants grown for flowers in greenhouse production from four North Carolina counties showed symptoms of an angular leaf spot on leaves, stems, and flower parts. Lesions were initially small, dark brown, 1 to 3 mm in size, and vein-limited. As the disease progressed, lesions coalesced to form larger regions of necrosis that engulfed large portions of leaves, and whole plants were lost to disease. Red bacterial ooze was observed streaming from the plant tissues.
First Report of Sclerotinia Crown Rot Caused by Sclerotinia minor on Hemp
S. T. Koike, H. Stanghellini, S. J. Mauzey and A. Burkhard
Plant Disease Vol. 103, No. 7 July 2019
DOI: 10.1094/PDIS-01-19-0088-PDN
In summer 2018, commercial field grown hemp (Cannabis sativa L.) plants in San Benito County, CA, showed signs of a disease. Leaves initially wilted and turned dark green. Foliage eventually dried up completely. The base of the plant crown in contact with soil supported the growth of white to gray mycelium and small (0.5 to 3 mm diameter), irregularly shaped, black sclerotia. Crown tissue beneath the epidermis was necrotic. However, plant roots appeared symptomless. To estimate disease incidence, eight replicates of 100 plants each were assessed for collapse symptoms and sclerotia on plant crowns. Overall disease incidence was limited and was approximately 1%. To test for pathogens, symptomatic crown pieces were surface sterilized in 0.006% NaOCl for 2 min and plated on acidified (2 ml of 25% lactic acid/liter) corn meal agar. After 2 to 3 days, rapidly growing, colorless, appressed mycelium emerged from crown pieces
First report of Sclerotinia sclerotiorum causing stem canker on Cannabis sativa L. in Oregon
A.R. Garfinke
CBD Oregon
https://apsjournals.apsnet.org/doi/p...10-20-2142-PDN
In August of 2020, plants of Cannabis sativa L. grown in hoop houses at two farms located in Benton County, Oregon exhibited wilting and chlorosis, followed by shoot necrosis. Symptomatic plants had dry, tan-brown lesions or cankers, often accompanied by large, round to irregular or ribbon-shaped, black sclerotia and/or profuse white mycelial growth. Lesions or cankers were observed on the stems at both the plant crown (soil) level and higher in the canopy; flower infections were not observed. Sclerotia were removed from two infected plants and placed on potato dextrose agar (PDA) at room temperature. Fast-growing, pure white, largely appressed, sterile mycelium grew radially from plated sclerotia. Hyphal tips were transferred to obtain a pure culture. Additional sclerotia, solitary and aggregate, approximately 30 to more than 50 per plate, exhibiting identical features to those observed on plant tissue, formed in culture 6-7 days following transfer and ranged in size from 2 to 11 mm in length or width (n=50). Mycelia were aseptically harvested from cultures for DNA extraction (Quick-DNA Plant/Seed Miniprep Kit, Zymo Research). Primers ITS1-F (Gardes and Bruns 1993) and ITS4 (White et al. 1990) were used to amplify the internal transcribed spacer region (ITS) and primers G3PDHfor and G3PDHrev were used to amplify the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene (Staats et al. 2005) from a single isolate, LAS01. The ITS region from LAS01 (MW079844) shared 100 to >99% homology to several Sclerotinia species isolates in GenBank
First Report of Southern Blight Caused by Sclerotium rolfsii on Hemp (Cannabis sativa) in Sicily and Southern Italy.
Pane A, Cosentino SL, Copani V, Cacciola SO
Plant Dis. 2007 May;91(5):636.
doi: 10.1094/PDIS-91-5-0636A
Hemp (Cannabis sativa L.), family Cannabaceae, is an annual herbaceous plant that is 1.5 to 4.0 m tall and native to the Caucasus Region, northern India, and Iran. It is cultivated in warm to temperate regions worldwide for its fiber, oil, and psychoactive substances. In Europe, commercial plantings have decreased from 52,872 ha in 1989 to 18,716 ha in 2005. Recently however, cultivation of hemp as a natural fiber species has been encouraged by European Union policy (2). During the summer of 2003, patches of dead plants were observed in test plots of 12 monoecious and dioecious hemp cultivars (Beniko, Epsylon 68, Felina 34, Ferimon, Fedora 17, Futura 75, Bialobrzeskie, Dioica 88, Fibranova, Tiborszallasi, Lovrin, and Carmagnola) in an experimental field near Catania (eastern Sicily) previously planted to artichoke (Cynara scolymus L.). Plots were irrigated with a drip irrigation system. Symptoms were first detected in July with day/night temperatures between 35 and 26°C. Infected plants showed a dark brown-to-tan discoloration of the stem near the soil line. As disease progressed, the rot extended down to the crown and taproot, foliage became yellow, and the entire plant eventually collapsed. An extensive white, cottony mycelium and numerous spherical tan-to-dark brown sclerotia (0.5 to 4.0 mm in diameter) developed externally on infected tissues and soil. As much as 60% of the plants were affected in a single plot. Monoecious cultivars that had been planted earlier escaped the disease. Isolations from diseased tissues were performed by plating symptomatic tissues previously disinfected for 1 min in 1% NaOCl and rinsed in sterile water on acidified potato dextrose agar (pH 4.5). Isolations consistently yielded a fungus whose characters corresponded to Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough). Pathogenicity of two isolates obtained from infected plants was confirmed by inoculating 120-day-old hemp plants grown in individual pots. Twenty plants for each of the above listed cultivars (10 plants for each isolate) were inoculated by applying toothpick tips (5 mm) colonized by S. rolfsii to the lower part of the stem. Ten noninoculated plants served as controls. Plants were kept in a greenhouse with temperatures between 26 and 32°C and 95% relative humidity. High soil moisture was maintained with frequent watering. All inoculated plants showed blight and basal stem rot after 2 weeks, irrespective of the cultivar. By the third week, plants began to dry up and mycelium and sclerotia developed on the crown. Noninoculated controls remained symptomless. S. rolfsii was reisolated from inoculated plants. Although S. rolfsii has been reported on hemp in India since the 1930s (3), to our knowledge, this is the first report of southern blight caused by this fungus on C. sativa in Sicily and southern Italy. Residues of artichoke, a very susceptible host of S. rolfsii (1), might have been the source of inoculum for this outbreak on hemp. Most likely, high summer temperatures and overirrigation exacerbated the disease severity.
First Report of white root rot of hemp (Cannabis sativa L.) caused by Dematophora necatrix in Campania region (Southern Italy)
R. Sorrentino, G. M. Baldi, V. Battaglia, F. Raimo, G. Piccirillo, E. Lahoz
Plant Dis. 2021 Apr 1
https://apsjournals.apsnet.org/doi/p...07-20-1521-PDN
Industrial hemp (Cannabis sativa L.) was cultivated in Italy until the end of Second World War. Since then, it
has been abandoned and substituted with other crops mainly due to legal restrictions and public concerns.
Public legislation passed in 2016, has allowed for the production of hemp seeds, flowers and fibers (law n.
242/2016). During a 2019 survey on hemp sanitary status in the province of Naples (40°57'6"12 N,
14°22'37"56 E), plants ‘Kompolty’ with symptoms of root rot were observed at a private farm and collected
for further analysis at the phytosanitary laboratory of CREA in Caserta. Death generally occurred within 2-3
weeks after the appearance of the first symptoms, occurring on ca. 10% of plants, consisting of yellowing,
canopy wilt and signs of roots covered with white mycelium and fan-like mycelium under the bark. The causal
agent, was isolated from small root segments were excised from symptomatic plants, the surface was
disinfected with 2% sodium hypochlorite, placed on potato dextrose agar (PDA) amended with streptomycin
sulphate (100mg/L) and incubated in the dark at 25°C for 5 days. Small pieces (2-3 mm) at the edge of the
resulting colonies were sub-cultured onto PDA and incubated at 25°C in the dark for one week. The mycelia
from 15 isolates showed pear-shaped swellings adjacent to the septa.
First Report of Witches'-Broom Disease in a Cannabis spp. in China and Its Association with a Phytoplasma of Elm Yellows Group (16SrV).
Zhao Y1, Sun Q1, Davis RE1, Lee IM1, Liu Q2.
Plant Dis. 2007 Feb;91(2):227.
doi: 10.1094/PDIS-91-2-0227C.
Hemp fiber plants (Cannabis spp.) spread naturally in almost every climate zone in China and have a long history of cultivation in the country (1). While hemp stalks provide high-quality fibers for making ropes, clothes, and paper products, hemp seeds are a rich source of edible oil. During the summer of 2004, a disease characterized by witches'-broom symptoms was observed in wild hemp fiber plants growing in suburban Taian, Shandong, China. The diseased plants developed clusters of highly proliferating branches with much shortened internodes and leaves on the affected branches were significantly reduced in size. Phytoplasma infection was suspected in this hemp fiber witches'-broom (HFWB) disease because of the typical symptoms and because of its geographic location where other phytoplasmal diseases such as jujube witches'-broom (JWB), paulownia witches'-broom (PaWB), paper mulberry witches'-broom (PMWB), and Chinese wingnut witches'-broom (CWWB) diseases were previously reported (3,4). Total DNA was extracted from leaves of four diseased and four nearby healthy looking hemp fiber plants. Nested PCR were carried out on the DNA samples using phytoplasma universal 16S rDNA primers (P1A/16S-SR and R16F2n/R16R2) (2). Results revealed that all examined diseased plants were infected by phytoplasma, whereas nearby healthy looking plants were phytoplasma free. Subsequent restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 1.25-kb 16S rDNA R16F2n/R16R2 fragment indicated that the phytoplasma associated with HFWB disease belongs to subgroup 16SrV-B of the elm yellows (EY) phytoplasma group. Nucleotide sequence analysis of the cloned HFWB phytoplasma partial rRNA operon (GenBank Accession No. EF029092), spanning a near full-length 16S rRNA gene and a partial 16S-23S rRNA intergenic spacer, suggested that HFWB phytoplasma is most closely related to JWB and PMWB phytoplasmas, both members of subgroup16SrV-B. To further characterize the HFWB phytoplasma, a genomic segment covering full-length ribosomal protein genes rplV and rpsC was PCR-amplified using primer pair rp(V)F1A/rp(V)R1A (2), cloned, and sequenced (GenBank Accession No. EF029093). The nucleotide sequence of the HFWB phytoplasma rplV and rpsC locus is nearly identical (99.9%) to that of JWB phytoplasma. To our knowledge, this is the first report of a phytoplasmal disease in Cannabis spp. Since HFWB and JWB phytoplasmas share extremely high sequence identity and share the same eco-geographic location, further investigation is warranted to determine whether these two phytoplasmas are actually one species that can infect both plants, an issue having important implications in managing both diseases. References: (1) S. Hong and R. C. Clarke. J. Int. Hemp Assoc. 3:55, 1996. (2) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:337, 2004. (3) Q. Liu et al. Plant Dis. 88:770, 2004. (4) Q. Liu et al. Plant Dis. 89:529, 2005.
Flower and foliage-infecting pathogens of marijuana (Cannabis sativa L.) plants.
Punja, Z. K.
Canadian Journal of Plant Pathology. (2018).
doi:10.1080/07060661.2018.1535467
Flower buds of Cannabis sativa develop as inflorescences (buds) which are harvested and dried prior to sale. The extent to which fungal plant pathogens can colonize the buds prior to harvest has not been previously studied. Flower buds were sampled at various preharvest and harvest time periods during 2015–2017 at locations in British Columbia and Alberta to determine the range of fungi present. Isolated fungi were inoculated onto developing buds to determine the extent of tissue colonization. A pre- and post-harvest internal rot was associated with Botrytis cinerea, causing botrytis bud rot. In addition, two species of Penicillium – P. olsonii and P. copticola – were recovered from pre-harvest flower buds, as well as dried buds, and shown to cause penicillium bud rot. Scanning electron microscopy studies revealed colonization and sporulation on bracts and stigmas of the flower buds by P. olsonii. Several Fusarium species, which were identified using ITS rDNA sequences as F. solani, F. oxysporum and F. equiseti, were isolated from pre-harvest flower buds. These fungi colonized the flower buds following artificial inoculation and caused visible rot symptoms. The most severe symptoms were caused by F. solani, followed by F. oxysporum and, to a much lesser extent, F. equiseti. Powdery mildew infection of the foliage and flower buds was caused by Golovinomyces(Erysiphe) cichoracearum. The pathogen was detected on young vegetatively propagated cuttings and sporulation was abundant on older plants and on flower buds. The various fungi recovered from cannabis flower buds may be present as contaminants from aerially dispersed spores and have the potential to cause various types of pre- and post-harvest bud rot under conducive environmental conditions. Powdery mildew may be spread through aerially disseminated spores and infected propagation materials. Management of these pathogens will require monitoring of the growth environment for spore levels and implementation of sanitization methods to reduce inoculum sources.
Not directly Cannabis related
Fomitopsis betulina (formerly Piptoporus betulinus): the Iceman's polypore fungus with modern biotechnological potential
Małgorzata Pleszczyńska , Marta K Lemieszek , Marek Siwulski , Adrian Wiater , Wojciech Rzeski , Janusz Szczodrak
World J Microbiol Biotechnol (2017) 33:83 . 2017 May;33(5):83.
doi: 10.1007/s11274-017-2247-0
https://www.ncbi.nlm.nih.gov/pmc/art...ticle_2247.pdf
Higher Basidiomycota have been used in natural medicine throughout the world for centuries. One of such fungi is Fomitopsis betulina (formerly Piptoporus betulinus), which causes brown rot of birch wood. Annual white to brownish fruiting bodies of the species can be found on trees in the northern hemisphere but F. betulina can also be cultured as a mycelium and fruiting body. The fungus has a long tradition of being applied in folk medicine as an antimicrobial, anticancer, and anti-inflammatory agent. Probably due to the curative properties, pieces of its fruiting body were carried by Ötzi the Iceman. Modern research confirms the health-promoting benefits of F. betulina. Pharmacological studies have provided evidence supporting the antibacterial, anti-parasitic, antiviral, anti-inflammatory, anticancer, neuroprotective, and immunomodulating activities of F. betulina preparations. Biologically active compounds such as triterpenoids have been isolated. The mushroom is also a reservoir of valuable enzymes and other substances such as cell wall (1→3)-α-D-glucan which can be used for induction of microbial enzymes degrading cariogenic dental biofilm. In conclusion, F. betulina can be considered as a promising source for the development of new products for healthcare and other biotechnological uses.
Fool’s gold: diseased marijuana and cannabis hyperemesis syndrome
Oscar Armando Dorantes
J Investig Med 2021;69:1063–1064.
doi:10.1136/jim-2021-001980
https://jim.bmj.com/content/jim/69/5/1063.full.pdf
I am writing in response to the article by Gajendran et al1 and the editorial by Ron Shay, 'Cannabis hyperemesis syndrome: the conundrum
is here to stay'.2 As an emic cultural investigator (anthropologist) and from my vantage point, the problem of cannabis hyperemesis syndrome could easily go away just as quickly as it has appeared. There is a large disconnect between the professional medical community and the marijuana subculture. The majority of the latter are somewhat in denial that cannabis is the cause of this condition and, on the flip side, doctors feel strongly about their conclusions. Perhaps both can be right, because in the marijuana subculture community there are two types of marijuana: 'the sticky, skunky weed' or the 'the bunk weed', 'the dank or the regs' or otherwise viewed as the 'good stuff versus not good stuff'. Were any of the samples of consumed marijuana analyzed during the marijuana hyperemesis diagnosis, as presented in Gajendran et al's paper?
Fungal Pathogens Affecting the Production and Quality of Medical Cannabis in Israel.
Jerushalmi, S., Maymon, M., Dombrovsky, A., & Freeman, S.
Plants, 9(7), 882. (2020).
doi:10.3390/plants9070882
The use of and research on medical cannabis (MC) is becoming more common, yet there are still many challenges regarding plant diseases of this crop. For example, there is a lack of formal and professional knowledge regarding fungi that infect MC plants, and practical and effective methods for managing the casual agents of disease are limited. The purpose of this study was to identify foliar, stem, and soilborne pathogens affecting MC under commercial cultivation in Israel. The predominant major foliage pathogens were identified as Alternaria alternata and Botrytis cinerea, while the common stem and soilborne pathogens were identified as Fusarium oxysporum and F. solani. Other important fungi that were isolated from foliage were those producing various mycotoxins that can directly harm patients, such as Aspergillus spp. and Penicillium spp. The sampling and characterization of potential pathogenic fungi were conducted from infected MC plant parts that exhibited various disease symptoms. Koch postulates were conducted by inoculating healthy MC tissues and intact plants with fungi isolated from infected commercially cultivated symptomatic plants. In this study, we report on the major and most common plant pathogens of MC found in Israel, and determine the seasonal outbreak of each fungus.
Fusarium and Pythium species infecting roots of hydroponically grown marijuana (Cannabis sativa L.) plants.
Punja, Z. K., & Rodriguez, G.
Canadian Journal of Plant Pathology. (2018).
doi:10.1080/07060661.2018.1535466
An increase in the cultivation of Cannabis sativa (cannabis or marijuana) plants in Canada is becoming associated with increased incidence and severity of various diseases, many of which have not been previously reported. In this study, hydroponically grown C. sativa plants were sampled over a 3-year period (2014-2017) to determine the prevalence of root pathogens. Following isolation, pathogenicity studies were conducted to establish the extent of disease symptoms caused by the recovered microbes. Root rot was found to be caused by two Pythium species - Pythium dissotocum Drechsler and P. myriotylum Drechsler. As well, two Fusarium species were recovered from diseased plants - Fusarium oxysporum Schlecht. emend. Snyder & Hansen and F. solani (Mart.) Sacc. Upon inoculation onto healthy plants, all isolates of Pythium spp. caused browning and a reduction in root mass, accompanied by stunting. Inoculation of plants with F. oxysporum caused browning of roots and crown rot infection, accompanied by pith and vascular discoloration, and in some cases wilting of plants, while root and crown infection was observed with F. solani. Phylogenetic analysis of internal transcribed spacer (ITS) and elongation factor 1 ? (EF-1 ?) sequences revealed that the Fusarium species affecting cannabis plants shared 99-100% sequence homology with isolates causing stem rot and wilt in other hosts, including cumin and tomato, suggesting they were not uniquely adapted to cannabis. The potential for spread of F. oxysporum through the hydroponic system was confirmed by its detection in the recirculating nutrient solution. Furthermore, rooted cuttings obtained from commercial propagators were found to harbor Fusarium root infection that resulted in subsequent stunting, yellowing and occasional death of plants. This demonstrates the potential for long-distance spread of the pathogen. The two Pythium species recovered from cannabis plants have an extremely broad host range and are not unique to this host. An additional species, P. aphanidermatum (Edson) Fitzp., was recovered from diseased plants grown under greenhouse conditions in 2018. The management of these root pathogens on C. sativa will require the evaluation and implementation of sanitization methods, biological
control agents, and chemical products adapted from greenhouse vegetable production practices. The use of pathogen-free propagation materials and identification of potential sources of disease resistance should also become a priority.
Fusarium Oxysporum f. sp. Cannabis Isolated from Cannabis Sativa L.: In Vitro and In Planta Biocontrol by a Plant Growth Promoting-Bacteria Consortium
Marika Pellegrini, Claudia Ercole Carmslo Gianchino, Matteo Bernardi, Loretta Pace and Maddalena Del Gallo
Plants 2021, 10(11), 2436;
DOI: 10.3390/plants10112436
https://mdpi-res.com/d_attachment/pl...0-02436-v2.pdf
Industrial hemp (Cannabis sativa L.) is a multipurpose plant used in several fields. Several phytopathogens attack hemp crops.Fusarium oxysporum is a common fungal pathogen that causes wilt disease in nurseries and in field cultivation and causes high losses. In the present study, a pathogenic strain belonging to F. oxysporum f. sp. cannabis was isolated from a plant showingFusarium wilt. After isolation, identification was conducted based on morphological and molecular characterizations and pathogenicity tests. Selected plant growth-promoting bacteria with interesting biocontrol properties—Azospirillum brasilense,Gluconacetobacter diazotrophicus, Herbaspirillum seropedicae and Burkholderia ambifaria—were tested against this pathogen. In vitro antagonistic activity was determined by the dual culture method. Effective strains (in vitro inhibition > of 50%) G. diazotrophicus, H. seropedicae and B. ambifaria were combined in a consortium and screened for in planta antagonistic activity in pre-emergence (before germination) and post-emergence (after germination). The consortium counteracted Fusarium infection both in pre-emergence and post-emergence. Our preliminary results show that the selected consortium could be further investigated as an effective biocontrol agent for the management of this pathogen
Fusarium Wilt
John M. McPartland, Karl W. Hillig
Dec 22, 2004 Journal of Industrial Hemp· Vol. 9(2) 2004
DOI :10.1300/J237v09n02_07Copy DOI
Fusarium wilt is caused by two closely-related fungi, Fusarium oxysporum f. sp. vasinfectum and Fusarium oxysporum f. sp. cannabis. The disease was first described on hemp in Eastern Europe about 50 years ago, but is now found throughout the Northern hemisphere. Greenhouse studies demonstrated that all cultivars of Cannabis that were tested are susceptible. Signs and symptoms, life history of the pathogens, and control measures are discussed. Fusarium wilt is a menace to hemp cultivation worldwide because its causal fungi cannot be constrained by known organic control measures. The disease threat is compounded by misguided attempts to spread the fungi around the world to stop illicit marijuana cultivation.
Not Cannabis specific
Genetic Engineering of Terpenoid Metabolism Attracts Bodyguards to Arabidopsis
Iris F. Kappers, Asaph Aharoni, Teun W. J. M. van Herpen, Ludo L. P. Luckerhoff, Marcel Dicke, Harro J. Bouwmeester
SCIENCE 23 SEPT 2005 VOL 309
DOI: 10.1126/science.1116232
Herbivore-damaged plants release complex mixtures of volatiles that attract
natural enemies of the herbivore. To study the relevance of individual components of these mixtures for predator attraction, we manipulated herbivoryinduced volatiles through genetic engineering. Metabolic engineering of terpenoids, which dominate the composition of many induced plant volatile bouquets, holds particular promise. By switching the subcellular localization of the introduced sesquiterpene synthase to the mitochondria, we obtained transgenic Arabidopsis thaliana plants emitting two new isoprenoids. These altered plants attracted carnivorous predatory mites (Phytoseiulus persimilis) that aid the plants’ defense mechanisms
It is actually more important to eliminate any MLO susceptibility genes in a Cannabis variety, to have no PM. While the resistance gene PM1 is an important discovery, elimination of any MLO susceptibility genes will confer better protection to PM. Breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
*Genome-wide characterization of the MLO gene family in Cannabis sativa reveals two genes as strong candidates for powdery mildew susceptibility
Noémi Pépin, Francois Olivier Hebert, and David L. Joly
Biorxiv 2021
DOI: 10.1101/2021.07.16.452661
https://www.biorxiv.org/content/10.1...661v1.full.pdf
Cannabis sativa is increasingly being grown around the world for medicinal, industrial, and recreational purposes. As in all cultivated plants, cannabis is exposed to a wide range of pathogens, including powdery mildew (PM). This fungal disease stresses cannabis plants and reduces flower bud quality, resulting in significant economic losses for licensed producers. The Mildew Locus O (MLO) gene family encodes plant-specific proteins distributed among conserved clades, of which clades IV and V are known to be involved in susceptibility to PM in monocots and dicots, respectively. In several studies, the inactivation of those genes resulted in durable resistance to the disease. In this study, we identified and characterized the MLO gene family members in five different cannabis genomes. Fifteen Cannabis sativa MLO (CsMLO) genes were manually curated in cannabis, with numbers varying between 14, 17, 19, 18, and 18 for CBDRx, Jamaican Lion female, Jamaican Lion male, Purple Kush, and Finola, respectively (when considering paralogs and incomplete genes). Further analysis of the CsMLO genes and their deduced protein sequences revealed that many characteristics of the gene family, such as the presence of 7 transmembrane domains, the MLO functional domain, and particular amino acid positions, were present and well conserved. Phylogenetic analysis of the MLO protein sequences from all five cannabis genomes and other plant species indicated seven distinct clades (I through VII), as reported in other crops. Expression analysis revealed that the CsMLOs from clade V, CsMLO1 and CsMLO4, were significantly upregulated following Golovinomyces ambrosiae infection, providing preliminary evidence that they could be involved in PM susceptibility. Finally, the examination of variation within CsMLO1 and CsMLO4 in 32 cannabis cultivars revealed several amino acid changes, which could affect their function. Altogether, cannabis MLO genes were identified and characterized, among which candidates potentially involved in PM susceptibility were noted. The results of this study will lay the foundation for further investigations, such as the functional characterization of clade V MLOs as well as the potential impact of the amino acid changes reported. Those will be useful for breeding purposes in order to develop resistant cultivars.
Hemp and Cannabis Crop Diseases A guide to field diagnosis and management
Shouhua Wang
Nevada Dept of Agriculture
Power Point https://agri.nv.gov/uploadedFiles/ag...management.pdf and also a Book
www.cabi.org/bookshop/book/9781789246070
Defining Hemp: A Fact Sheet
“Botanically, hemp and marijuana are from the same species of plant, Cannabis sativa, but from different varieties or cultivars. However, hemp and marijuana are genetically distinct forms of cannabis that are distinguished by their use and chemical composition as well as by differing cultivation practices in their production. While marijuana generally refers to the cultivated plant used as a psychotropic drug (whether used for medicinal or recreational purposes), hemp is cultivated for use in the production of a wide range of products, including foods and beverages, personal care products, nutritional supplements, fabrics and textiles, paper, construction materials, and other manufactured and industrial goods. Hemp and marijuana also have separate statutory definitions in U.S. law.”
*Hemp Diseases and Pests Management and Biological Control
J.M. McPartland, Robert Connell Clarke, David Paul Watson
CABI Publishing 251 pages
https://avalonlibrary.net/ebooks/Rob...%20Control.pdf
As the 21st century begins, we are favoured with a worldwide resurgence in hemp cultivation. As global forests dwindle to rampikes and timber limits, we see a glimmer of hope for our future, thanks to a renewed interest in this ancient and humble source of food and fibre. This book is our contribution to hemp's revival. Much of the literature regarding hemp diseases and pests dates back 50 years or more. Further, these publications are frequently buried in obscure agronomy journals. Cultivators of illicit Cannabis have published high-calibre research in the last 25 years, but they published in semi-clandestine "grey journals" such as Sinsenzilla Tips. Our primary effort was to collect this scattered bibliography and assimilate it into a comprehensive and readable format.
Our second effort was to manoeuvre the control of diseases and pests into the 21st century. Most hemp research dates to the days when DDT was considered a glamorous panacea. We must find new control methods for sustainable hemp cultivation. Many "new" pesticides are old, such as pyrethrum, a popular insecticide before the days of DDT. Biological control also is old; the use of biocontrol against hemp pests began around 1886, in France. Etre une tete a Papineau, we see biocontrol and hemp resurging together.
Hemp Diseases in North Carolina
Lindsey Thiessen 2017-2018
https://growingsmallfarms.ces.ncsu.e.. .sen.pdf?fwd=no
• Things learned:
• Potential disease problems for producers in NC
• Good/bad growing conditions for hemp
• Things still unknown:
• Chemical management options
• Can use labeled chemistries under FIFRA 25b list until more added
• Environmental condition impact in 2019
Hemp Pest Spectrum and Potential Relationship between Helicoverpa zea Infestation and Hemp Production in the United States in the Face of Climate Change
Olufemi S. Ajayi and Michelle Samuel-Foo
Insects 2021, 12,940.
DOI: 10.3390/insects12100940
https://www.mdpi.com/2075-4450/12/10/940
Simple Summary: Cultivation of industrial hemp Cannabis sativa in the United States is now being expanded due to the recent legalization of the crop. Multiple insect pests attack the crop. One of the common pests is the corn earworm Helicoverpa zea that causes extensive damage to the marketable parts of hemp. Changing global climate may lead to expansion of the geographic range of insect pests. Thus, growers of this crop in the United States have to face new and intense pest problems now and in the years to come. Here, we assess the potential relationship between corn earworm infestation and hemp production in the US in the face of climate change. We also provide an update on the arthropods associated with hemp cultivation across the US. Climate change can affect aspects of interactions between hemp and corn earworm. Temperature and photoperiod affect the development and diapause process in H. zea. Drought leads to a reduction in hemp growth. Overall, our assessment suggests the selection of varieties resistant to stresses from climate and insects. Host plant diversity may prevent populations of corn earworm from reaching outbreak levels. Ongoing research on effective management of H. zea on hemp is critical.
Abstract: There has been a resurgence in the cultivation of industrial hemp, Cannabis sativa L., in the United States since its recent legalization. This may facilitate increased populations of arthropods associated with the plant. Hemp pests target highly marketable parts of the plant, such as flowers, stalks, and leaves, which ultimately results in a decline in the quality. Industrial hemp can be used for several purposes including production of fiber, grain, and cannabidiol. Thus, proper management of pests is essential to achieve a substantial yield of hemp in the face of climate change. In this review, we provide updates on various arthropods associated with industrial hemp in the United States and examine the potential impact of climate change on corn earworm (CEW) Helicoverpa zea Boddie, a major hemp pest. For example, temperature and photoperiod affect the development and diapause process in CEW. Additionally, drought can lead to a reduction in hemp growth. Host plant diversity of CEW may prevent populations of the pest from reaching outbreak levels. It is suggested that hemp varieties resistant to drought, high soil salinity, cold, heat, humidity, and common pests and diseases should be selected. Ongoing research on effective management of CEW in hemp is critical.
History, Origin, and Diversity of Hop Stunt Disease and Hop Stunt Viroid
T. Sano
Acta horticulturae 1010(1010):87-96 October 2013
DOI: 10.17660/ActaHortic.2013.1010.9
Hop stunt disease first emerged in Japan and reported as “dwarf hop” or “cedar-shaped hop” in the 1940s and the early 1950s. The disease emerged in Korea in 1988 and was confirmed in North America in 2004 and in China in 2007. The diseased plants develop yellowish green leaves and drooped leaf petioles in early to mid-growing season, and results in stunting of main and lateral bines. Depending on hop variety, visual stunting becomes apparent only several years after the infection. More serious is the reduction of the alpha-acid content, which is occasionally accompanied by reduction in the total cone numbers per vine. The alpha-acid content of sensitive cultivars is reduced to less than one half. Viroids are the smallest known pathogens and cause severe to mild diseases in economically important crops. They are single-stranded, circular, and self replicating non-coding RNAs with a size of 250 to 400 nucleotides. Viroid replication is dependent on host transcriptional machinery, and pathogenicity depends entirely on interactions with cellular components of the host. Hop stunt disease (HSD) is caused by the Hop stunt viroid (HpSVd), a member of the Pospiviroidae family. Infection of hops by Apple fruit crinkle viroid also exhibits similar disease symptoms. HpSVd was first discovered from the dwarfed-hop, but soon after, it was found to have infected cultivated grapevines, citrus and stone fruits, including plum, peach, apricot, almond and Jujube. HpSVd is now considered to be a ubiquitous and genetically variable pathogen that has spread among cultivated crops worldwide. Unfortunately, all the HpSVd isolates have a potential to cause hop stunt, and current HSD epidemics in Japan, USA, and China may have originated from inter-specific transmission of HpSVd from cultivated grapevines to hops.
Host-Parasite Relationships in Cannabis
John McPartland, Karl Hillig
October 2005 Journal of Industrial Hemp 10(2):85-104
DOI: 10.1300/J237v10n02_08
Plant taxonomy is primarily based on patterns of morphologicalvariation and geographical distribution. Plant-parasite relationships can also offer clues regarding the phylogeny of the host plant. Many obligate parasites coevolve with their hosts, eventually becoming restricted to an individual taxon. Host restriction may take place at different taxonomic ranks, i.e., parasites may become restricted to one host genus within a plant family, to one species within a genus, or to one infraspecific taxon within a species. This phylogenetic congruence between plants and their parasites may be due to cospeciation or due to co-adaptation (reciprocal adaptive selection). Our study reviewed plantparasite interactions with regard to putative Cannabis taxa. The results suggest that certain parasites may have co-evolved with putative species and biotypes within the Cannabis genus.
Identifying Unknown Microbiological Contaminants in Cannabis
Jack Rudd, Analytical Cannabis
https://www.analyticalcannabis.com/a...annabis-311544
We know microbiological contaminants pose a potential risk to cannabis consumers. In particular, bacteria and fungi may cause opportunistic infections immunocompromised individuals and even dead or dormant organisms may present a threat. As regulations have evolved across the US and Canada, it has become clear that robust, routine microbiological testing is essential in protecting consumer safety for medical patients and recreational users alike. As things stand, a patchwork of different testing regulations mandate a range of testing requirements across the US, and discussions on the best approach to guaranteeing accurate, reliable results are ongoing.
To find out more about the challenges faced and the technology available to the industry, we spoke to Amrita Puri, a Field Marketing Specialist with Bio-Rad, which offers a range of validated molecular- and culture-based
diagnostic tools for the detection of pathogens in cannabis and other products.
Industrial Hemp Crop Diseases What We’ve Seen and What We Know
Shouhua Wang, Ph.D.
State Plant Pathologist Nevada Department of Agriculrure
https://agri.nv.gov/uploadedFiles/ag...203-7-2018.pdf
A plant disease is a result of interaction of three factors:
Host - A susceptible host plant is available
Pathogen - A pathogen is present
Environment - Environmental conditions that favour the host and pathogen to allow disease development
Insecticidal activity and biochemical composition of Citrullus colocynthis, Cannabis indica and Artemisia argyi extracts against cabbage aphid (Brevicoryne brassicae L.).
Ahmed, M., Peiwen, Q., Gu, Z., Liu, Y., Sikandar, A., Hussain, D., Ji, M.
Scientific Reports, 10(1). (2020).
doi:10.1038/s41598-019-57092-5
Plant extracts contain many active compounds, which are tremendously fruitful for plant defence against several insect pests. The prime objectives of the present study were to calculate the extraction yield and to evaluate the leaf extracts of Citrullus colocynthis (L.), Cannabis indica (L.) and Artemisia argyi (L.) against Brevicoryne brassicae and to conduct biochemical analysis by gas chromatography-mass spectrometry (GC-MS). The results suggested that when using ethanol, C. colocynthis produced a high dry yield (12.45%), followed by that of C. indica and A. argyi, which were 12.37% and 10.95%, respectively. The toxicity results showed that A. argyi was toxic to B. brassicae with an LC50 of 3.91mgmL?1 , followed by the toxicity of C. colocynthis and C. indica, exhibiting LC50 values of 6.26 and 10.04mgmL?1 , respectively, which were obtained via a residual assay; with a contact assay, the LC50 values of C. colocynthis, C. indica and A. argyi were 0.22mgmL?1 , 1.96 and 2.87mgmL?1 , respectively. The interaction of plant extracts, concentration and time revealed that the maximum mortality based on a concentration of 20mgL?1 was 55.50%, the time-based mortality was 55% at 72h of exposure, and the treatment-based mortality was 44.13% for A. argyi via the residual assay. On the other hand, the maximum concentration-based mortality was 74.44% at 20mgmL?1 , the time-based mortality was 66.38% after 72h of exposure, and 57.30% treatment-based mortality was aforded by A. argyi via the contact assay. The biochemical analysis presented ten constituents in both the A. argyi and C. colocynthis extracts and twenty in that of C. indica, corresponding to 99.80%, 99.99% and 97% of the total extracts, respectively. Moreover, the detected caryophylleneonides (sesquiterpenes), ?-bisabolol and dronabinol (?9 -THC) from C. indica and erucylamide and octasiloxane hexamethyl from C. colocynthis exhibited insecticidal properties, which might be responsible for aphid mortality. However, A. argyi was evaluated for the frst time against B. brassicae. It was concluded that all the plant extracts possessed signifcant insecticidal properties and could be introduced as botanical insecticides after feld evaluations
IPM for Cannabis Pests
William Quarles
IPM Practitioner, XXXVI (5/6) Published August 2018
https://www.birc.org/IPMPCannabis.pdf
About 35 million people in the U.S. use marijuana on a regular basis. It is the fourth most popular recreational drug after caffeine, alcohol, and tobacco
(Ingraham 2017). Marijuana is legal for medical use in 31 states, and it has been decriminalized in 13 other states. Recreational marijuana is legal for adults in nine states, including Alaska, California, Colorado, Oregon, Maine, Massachusetts, Nevada, Vermont, and Washington. Legalization in Michigan and New Jersey is expected soon. There are only four states where it is totally
illegal according to state law (Wikipedia 2018). Marijuana may be the largest
cash crop in the U.S. with an estimated value of $35.8 billion each year. Its closest rival is soybeans, whose value varies with yields, and recently with tariffs. Hemp also has a lot of economic potential. About $688 million of imported hemp products were sold in the U.S. in 2016 (Strickler 2018). Cultivation of both marijuana and hemp is illegal according to federal law. The federal government lists Cannabis as a Controlled Substances Act Schedule I drug and claims it has no medical value. The federal fate of marijuana is uncertain, but a law legalizing the cultivation of hemp throughout the U.S. was introduced into the U.S. Senate on April 12, 2018 (McConnell
2018).
NOT CANNABIS SPECIFIC
Interactions of insect pheromones and plant semiochemicals
Gadi V.P. Reddy and Angel Guerrero
TRENDS in Plant Science Vol.9 No.5 May 2004
doi:10.1016/j.tplants.2004.03.009
Plant semiochemicals are known to produce a wide range of behavioral responses in insects. Some insects sequester or acquire host plant compounds and use them as sex pheromones or sex pheromone precursors. Other insects produce or release sex pheromones in response to specific host plant cues, and chemicals from host plants often synergistically enhance the response of an insect to sex pheromones. Plant volatiles can also have inhibitory or repellent effects that interrupt insect responses to pheromones and attract predators and parasitoids to the attacking species after herbivory injury. Here, we review different interactions between plant semiochemicals and insect pheromones, paying attention to those that can result in the development of more efficient and reliable programs for pest control
NOT CANNABIS SPECIFIC
Investigation on some biological aspects of Chrysoperla lucasina (Chrysopidae: Neuroptera) on Bemisia tabaci in laboratory conditions
Alinaghi Mirmoayedi
Comm. Appl. Biol. Sci, Ghent University, 77/4, 2012
https://www.researchgate.net/publica...ory_conditions
Bemisia tabaci is one of the most important key pests of many types of cultivated plants. Lacewings (Chrysopidae: Neuroptera) are predatory insects, widely used in biological control programs. Between them green lacewing is a promising biological control agent of pests in green houses and crop fields.
In this study, gravid females of the green lacewing Chrysoperla lucasina (Lacroix) were captured from Sarepolzahab ( altitude 540m, latitude 34°,14´ N 46°,9´ E) in western part of Iran. Collected insects were reared in a growth chamber, under experimental conditions (25±1°C, 70±5% RH and a photoperiod of 16:8 L: D). Different diets were offered to larvae which consisted of a whitefly species B.tabaci, an aphid Myzus persica and also lyophilized powder of drone honeybee (Apis melifera). As different foods were used to nurish larvae, so for each diet, mean larval period were calculated, and finally means were compared to each other. Anova in MSTAT-C was used for analysis of variance, and Duncan multiple range test (DMRT) to compare between means. The results showed that larvae had maximum duration of 27±0.33 days when fed on honeybee lyophilized powder and the minimum value was 17.9±0.3 days for B. tabaci. 25±0.27 day recorded for M. persicae. Food preference of the 3rd instar larvae of green lacewing was surveyed, they showed a food preference to M. persicae, to compare with B. tabaci, as the former has a bigger body size, so more easily to be captured by the predator larvae. The 3rd instar larvae of lacewing were more voracious on preys, than the 1st or the 2nd instar larvae. Statistically speaking, there were a significantly difference when mean of different preys consumed by predator larvae were compared. We found, that when the predator larvae have fed on B.tabaci, their development time was shorter, and when arrived to adult stage, the adults showed, an improved fertility. The results indicated that the suitable prey not only can increase the rate of through accelerating developmental stages of the predator and by means of an increase in its pupal body weight consequently promoting the fecundity of resulting adults, but also can alter predators population density in relation to own production numbers.
Is Irradiation Treatment on Cannabis Too Good to be True
Medicinal Genomics Jan 3 2022
www.medicinalgenomics.com/irradiation-treatment-cannabis/
Isolation of the pathogens causing hemp stem disease
X. He, S. Gang Geng, K. Li, N. Zheng
January 2016
DOI: 10.5013/IJSSST.a.17.29.19
Hemp, with very strong vitality, is a kind of annual tall herbaceous plant. Hemp is naturally hardy and drought tolerant which grows well in a cold climate. Hemp plants can resist various plant diseases. Besides, hemp can fight against insect pests without toxic pesticides and chemical fertilizers and thus effectively improve the soil salinization. In this work, two strains of pathogenic fungi (DN1 and DN2) were isolated from lesion site of the hemp plant, by an observation of hypha and spore morphology, the DN1 and the DN2 are respectively determined as deuteromycotina Alternaria (Alternaria alternata) and Verticillium (M.Verticillium). At pH values between 4 and 14, the two fungi can grow normally and show a great ability to adapt to the environment. Effects of hemp on soil pH were determined by pot experiment. The results showed that hemp could repair the weak alkaline soil.
ISSUES AND MITIGATIONS Hop Latent Viroid
DR. JOHN BRUNSTEIN (SEGRA)
https://mcusercontent.com/205b36c25f...Whitepaper.pdf
Zoom video:
https://us02web.zoom.us/rec/play/5F5...x_zm_rhtaid=19
Large-scale crop loss is every grower’s nightmare, but unfortunately, it is becoming an increasingly common reality. Modern Cannabis pathogens such as Hop Latent Viroid (HLVd) are emerging and accelerating, particularly in California, the most mature cannabis market in the world. While California
has long been an inspiration to the global cannabis community as an established and thriving market, it now also needs to serve as a cautionary tale as global cannabis operators come into contact with a growing list of pathogens causing documented economic losses.
Jahniella bohemica
John McPartland, Karl Hillig
October 2006 Journal of Industrial Hemp 11(2):97-108
DOI: 10.1300/J237v11n02_08
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The fungus Jahniella bohemica damages hemp stalks in Europe. For 125 years this fungus has been confused with Leptosphaeria acuta, a fungus that infests nettle stalks. The morphology of J. bohemica is described in detail, compared to other Jahniella species, and also compared to L. acuta. The nomenclature of L. acuta is revised.
Jahniella bohemica Part II: Mistaken Identity with Septoria cannabis Infesting Hemp Stalks
John McPartland, Karl Hillig
May 2007 Journal of Industrial Hemp 12(1):63-74
DOI: 10.1300/J237v12n01_07
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The fungus Jahniella bohemica damages hemp stalks in
Europe. In the previous issue of “Cannabis Clinic” we illustrated Jahniella bohemica and showed how this fungus has been confused with Leptosphaeria acuta, a fungus that infests nettle stalks. Jahniella bohemica has also been confused with Septoria cannabis, a fungus that usually attacks hemp leaves, but sometimes attacks hemp stalks. We now illustrate differences between these species, using novel methods of microchemistry, and emphasize the signs and symptoms of S. cannabis infestation.
Not Cannabis Specific
Keeping Your Environment Clean: Preventative Measures Against Contamination
By Jeff Scheir
https://cannabisindustryjournal.com/tag/uvc/
For years we have heard about and sometimes experienced, white powdery mildew when growing cannabis. It is a problem we can see, and we have numerous ways to combat it. But now more and more states are introducing regulatory testing on our harvests and they are looking for harmful substances like Escherichia coli., Aspergillis Fumigatus, Aspergillis terreus, … just to name a few. Mycotoxins, mold and bacteria can render a harvest unusable and even unsellable- and you can’t see these problems with the naked eye. How much would it cost you to have to throw away an entire crop?
You bring in equipment to control the humidity. You treat the soil and create just the right amount of light to grow a superior product. You secure and protect the growing, harvesting, drying and production areas of your facility. You do everything you can to secure a superior yield… but do you?
Many of the organisms that can hurt our harvest are being multiplied, concentrated and introduced to the plants by the very equipment we use to control the growing environment. This happens inherently in HVAC equipment.
Kenevir Cannabis sativa L Bitkilerinde Gorulen Virus Kaynakli Hastaliklar
Mehmet Ali Sevik
Türkiye Tarımsal Araştırmalar Dergisi 7 (1) Feb 2020 (in turkish)
DOI: 10.19159/tutad.663715
https://dergipark.org.tr/en/download...le-file/970960
https://www.researchgate.net/publica...=re413_x_i_pbf
Hemp (Cannabis sativa L.) belongs to Cannabis genus in Cannabinaceae family. Industrial hemp (C. sativa var. vulgaris L.), a variant of the C. sativa, is an important industrial crop. Industrial hemp is one of the oldest raw material resource crops know to humans. Hemp is cultivated to produce a vast variety of products such as hemp seeds, hemp oil, clothing, rope, paper, insulation, cosmetics, biodegradable plastics, construction material, resin, fuel, etc. Hemp is very sensitive to environmental conditions, diseases, and pests. Plants are more susceptible to diseases in adverse environmental conditions. More than 100 microorganisms (fungi, bacteria, virus, etc.) can cause disease in cannabis. In many studies conducted; hemp streak virus (HSV), hemp mosaic virus (HMV), alfalfa mosaic virus (AMV), cucumber mosaic virus (CMV) and arabis mosaic virus (ArMV) have been reported to cause diseases in hemp varieties. Also, tobacco mosaic virus (TMV),tobacco ringspot virus (TRSV), tobacco streak virus (TSV), tomato ringspot virus (TomRSV), eunoymous ringspot virus (ERSV), elm mosaic virus (EMV), and foxtail mosaic virus (FMV) are isolated from hemp plants. In recent years, studies on cannabis viruses have reported that beet curly top virus (BCTV) and lettuce chlorosis virus (LCV) infect cannabis plants.
Laboratory Bioassays of Biological/Organic Insecticides to Control Corn Earworm on Hemp in Virginia, 2019
Kadie E. Britt1 and Thomas P. Kuhar
Arthropod Management Tests 45(1) January 2020
DOI: 10.1093/amt/tsaa102
https://www.researchgate.net/publica..._Virginia_2019
Hemp acreage in the United States is increasing and outdoor crops are susceptible to corn earworm (CEW) feeding injury. Two separate bioassays were conducted in fall 2019 to evaluate the effects of biological/ organic insecticide products on CEW in hemp.
Bioassay 1 was initiated on 16 Sep 2019 and included the following treatments: Gemstar (Helicoverpa zea nuclear polyhedrosis virus [HzNPV]), Javelin (Bacillus thuringiensis var. kurstaki), DiPel (Bacillus thuringiensis var. kurstaki), XenTari (Bacillus thuringiensis var. aizawai + kurstaki), Venerate (94.5% Heatkilled Burkholderia spp. strain A396 cells and spent fermentation media), Grandevo (30% Chromobacterium subtsugae strain PRAA4-11 and spent fermentation media), Entrust (Spinosad), and an untreated check (Table 1). Third and fourth instar CEW larvae were collected from ears from an untreated field of sweet corn (Zea mays) established at Virginia Tech’s Kentland Farm in Whitethorne, VA (Kentland). Only vigorous larvae with fresh color were used for the experiment. On 16 Sep 2019, hemp seed heads (‘Felina-32’) were collected from field plots at Kentland, brought to the laboratory, and cut into ~9 cm3 sections. Forty hemp seed head sections were dipped into spray-tank concentrations of each treatment (Table 1) and placed individually into 1 oz plastic diet cups with a single CEW larva. A tray of 10 cups represented a replicate and four replicates were established for each treatment and placed in a different stack on the laboratory bench for the duration of the experiment. Diet cups were placed on the laboratory benchtop and held at laboratory ambient light and temperature (20–25°C) for 96 h and checked daily for mortality. Percent mortality data were analyzed with ANOVA procedures and means separated with Tukey’s HSD.
Bioassay 2 was initiated on 2 Oct 2019 and included the following treatments: Agree (Bacillus thuringiensis var. aizawai), Javelin (Bacillus thuringiensis var. kurstaki), Deliver (Bacillus thuringiensis var. kurstaki), XenTari (Bacillus thuringiensis var. aizawai + kurstaki), Pyganic (pyrethrins), Entrust (spinosad), and an untreated check (Table 2). The experiment was conducted using the same aforementioned procedures except that rather than using fieldcollected CEW, which were depleted from the field, we used third instars raised on artificial diet that were purchased from Benzon Research Inc., Carlisle, PA
Not Cannabis Specific
Mildew control with CleanLight technology
https://cleanlight.nl/wp-content/upl...March-2012.pdf
In September 2010, Horticultural News dedicated a few pages to the introduction of an exciting new crop protection technology in East Africa. It is a technology, not based on chemicals, but based on the use of cleansing light.
Mitochondrial COI Sequence Variations within and among Geographic Samples of the Hemp Pest Psylliodes attenuata from China.
Guo, L., Gao, F., Cheng, Y., Gao, C., Chen, J., Li, Z., … Xu, J.
Insects, 11(6), 370.(2020).
doi:10.3390/insects11060370
The hemp flea beetle Psylliodes attenuata (Coleoptera: Chrysomelidae: Psylliodes) is a common pest of Cannabis sativa, including cultivars of both industrial hemp and medicinal marijuana. Both the larval and adult stages of this beetle can cause significant damages to C. sativa, resulting in substantial crop losses. At present, little is known about the populations of this pest, including its genetic diversity. In this study, we obtained 281 P. attenuata samples from nine field sites representing broad industrial hemp productions in China and analyzed their DNA sequences at the mitochondrial COI gene, the insect DNA barcode. Our analyses revealed a total of 48 haplotypes, with 28 being found only in one specimen each while the remaining 20 were shared by two or more specimens each. Of the 20 shared haplotypes, eight were shared among local populations often from far away locations, consistent with recent long-distance dispersals. However, the observed putative long-distance dispersals have not obscured the significant genetic differentiations among the regional populations from northeastern, eastern, central and southwestern China. Interestingly, haplotype network analyses suggest evidence for potential mitochondrial recombination in natural populations of this species. We briefly discuss the implications of our results on its evolution, center of diversity, route of spread, and pest management strategies in hemp fields.
Not Cannabis specific
Molecular sampling of hop stunt viroid (HSVD) from grapevines in hop production areas in the Czech Republic and hop protection
J. Matousek, L. Orctová, J. Patzak, P. Svoboda, I. Ludvíková
PLANT SOIL ENVIRON., 49, 2003 (4): 168–175
https://www.researchgate.net/publication/264234891
Molecular sampling of HSVd in grapevines in the environs of hop gardens was performed. Specific RT PCR primers were designed to unambiguously distinguish between HLVd and HSVd infections. These primers were used for detection and analysis of HSVd cDNAs from individual samples by thermodynamic methods, TGGE and cDNA heteroduplex analysis. We found that at least 70% of grapevine samples from locations close to hop gardens in Northern Bohemia (atec and Útìk hop production areas) were infected with HSVd forming populations containing quasispecies. Particular sequence variants, dominant in grapevines from wine-growing areas like Znojmo, were also found in minor private vineyards. HSVd was experimentally transmissible (80% success) from these samples to Osvald’s clone 72 of Czech hop, where according to the cDNA library screening, one of the dominant HSVdg variants corresponding to AC E01844 was detected in early populations three weeks p.i. HSVd was detected neither in reproduction materials nor in examined hop gardens. However a potential danger for hop cultivation, consisting in the high biological potential of HSVd spread is discussed.
Kentucky Hemp Disease
Hemp Disease Management 101: Back to Basics
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/diseas...nt-basics.html
Diseases are managed first and foremost by prevention of infection by pathogens*. Once host plants are infected, disease** is not curable. Although some measures can suppress pathogens or slow symptom development, disease cannot be reversed or cured. Thus, it is recommended that preventative measures become priority in every system.
Introduction of diseased plant material into a field or greenhouse puts all healthy plants at risk for infection. Careful selection of plant material and adoption of production guidelines is critical. For example, new plants should remain separated for two to three weeks until they are confirmed to be disease (and insect) free. This period of quarantine helps protect existing healthy plant material.
On occasion, pathogens are introduced to production systems. Immediately upon identification/confirmation, protect healthy plants from infection and spread. Destroy, quarantine, and/or apply chemical treatments to infected plants. Nearby plants should be treated as infected and infective (even if symptoms have not yet developed). All diseased plant material is a threat to healthy plants, and thereby should be removed from production areas. As mentioned previously, disease cannot be cured or eradicated. Elimination of pathogens is only possible by extreme measures (e.g. crop destruction or greenhouse disinfestation).
• Disease101: Hemp Disease Management Basics
• ARTICLES:
• Septoria Leaf Spot
• Leaf Spot Diseases, An Overview
• Gray Mold (Botrytis) in the Greenhouse
• Powdery Mildew of Hemp
• Pythium Root Rot
• Sanitation for Disease Management in Greenhouse Hemp
• Sanitation for Disease Management in Field Hemp
• Cultural Calendar
• KY Hemp Disease
Disease Management Guide to Septoria Leaf Spot in the Field
Dr. Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/septoria-leaf-spot.html
Septoria sp.
Hemp (Cannabis sativa) is grown both outdoors and in greenhouses. Outdoor-grown hemp is susceptible to infection by leaf spot fungi that affect other crops and nearby plants, especially during periods of extensive rain or high humidity. There are three primary leaf spot diseases that affect hemp in Kentucky: Cercospora leaf spot, hemp leaf spot, and Septoria leaf spot. Septoria leaf spot is the most commonly reported of the leaf spot diseases.
Symptoms. Septoria leaf spot causes leaf spotting that can result in leaf loss and reduction of photosynthesis. Under extreme conditions, plants can lose 50% to 90% of leaves. If disease becomes severe early in the season, plant stunting and loss of vigor is possible. Plant death can occur under extreme conditions.
Disease symptoms begin in lower leaves and within the inner canopy where leaf wetness and high humidity occur. Disease begins as small irregularly shaped spots with bright yellow margins. Spots expand to about ¼ inch in diameter and appear brown with a prominent yellow halo. As spots enlarge, brown areas become more irregular and develop gray to white centers. Yellow halos expand outward from spots. Advanced symptoms include coalescence of yellow areas and/or coalescence of brown spots. Entire leaves rapidly become yellow and drop from plants.
Causal Agent. The fungus that causes Septoria leaf spot is a species within the genus Septoria. The precise causal species of Septoria leaf spot in Kentucky is currently under investigation. In general, Septoria spp. infect specific hosts or a specific group of hosts. For example, Septoria leaf spot of tomato causes disease on tomato and other solanaceous plants and Septoria tritici blotch of wheat affects only wheat and grass hosts. Neither of these diseases are caused by the same species that causes disease in hemp.
Septoria leaf spot spreads by spores called conidia. Infective conidia develop within capsule-like structures called pycnidia. Pycnidia appear as dark specks that resemble black pepper flakes in centers of spots; they contain large numbers of conidia. When excess moisture is present, conidia are released from pycnidia in a curling, oozing formation. Conidia move short distances via rain splash and long distances by wind-driven rain. Each conidium is capable of creating a new infection, and these new infections develop into leaf spots within 7-10 days.
Leaf Spot Diseases, An Overview
A Scientific Look at Diseases of Kentucky Hemp
Cercospora Spot
Septora Leaf Spot
Hemp Leaf Spot
https://www.kyhempdisease.com/leaf-s...-overview.html
Disease Management Guide to Gray Mold in the Greenhouse
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/gray-m...reenhouse.html
Botrytis cinerea
Hemp (Cannabis sativa x indica) is grown both outdoors and in greenhouses. High humidity greenhouses and other closed environments are often ideal for fungal diseases such as gray mold. Outdoor-grown hemp is susceptible during periods of high humidity or rain.
Symptoms. Gray mold develops primarily in flower buds and tightly-packed plant parts, and it is recognized by its gray moldy growth. Masses of mycelia (fungal strands) and clusters of conidia (asexual spores that are produced in large numbers) make up the dense gray mats. The fungus is commonly found in and between buds where microclimates are humid and air flow is limited. Severe infections can lead to yield loss as buds and flowers become infected.
While moldy buds are the most common disease phase, stems, petioles, and growing tips can also be affected. Pruning cuts, insect damage, and other openings are ideal for the opportunistic fungus. Once the fungus colonizes, it can girdle stems and cause them to break at the point of infection. Seedling infections and damping off can also result under humid conditions and in greenhouses with high levels of fungal contamination. Damping off in seedlings causes plant collapse.
Causal Agent. The fungus Botrytis cinerea is the causal agent of gray mold. It is ubiquitous, in that it is ever-present. Infection by the Botrytis fungus is dependent upon a wound or opening in plant tissue. Once infection takes place, though, the fungus can move from cell to cell, killing tissue as it spreads.
A single bud can host up to 1 million infective spores as humidity rises above 85%. These spores are carried by air currents to healthy plant material; fans, wind, and mechanical means can move spores, setting off a repeating disease cycle.
Management of Powdery Mildew Begins with Understanding the Causal Fungus
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/powder...w-of-hemp.html
Golovinomyces (synonym Erysiphe sp.)
Hemp (Cannabis sativa x indica) is grown both outdoors and in greenhouses. The environmental conditions of each system varies extensively, resulting in differing disease pressure. High humidity greenhouses and other closed environments are often ideal for fungal diseases such as powdery mildew. Outdoor-grown hemp is much less susceptible to the disease.
Powdery mildew diseases are caused by a group of fungi that develop fungal strands and chains of fungal spores on leaf surfaces and branch tips. Powdery mildew pathogens are host specific; each species of the fungus is specific to certain hosts. Thus, the species that infects Cannabis are restricted to hemp, hops, and a limited number of host plants. Likewise powdery mildew pathogens of surrounding plants (examples dogwood powdery mildew or rose powdery mildew) will not infect Cannabis spp. Golovinomyces sp. (synonym Erysiphe sp.) remains the most common of the powdery mildew pathogens that infect Cannabis spp.
Occurrence of Powdery Mildew Caused by Golovinomyces cichoracearum sensu lato on Cannabis sativa in Canada.
Pépin, N., Punja, Z., & Joly, D. L.
Plant Disease. (2018).
doi:10.1094/pdis-04-18-0586-pdn
Cannabis sativa, a flowering plant belonging to the Cannabaceae family, increasingly is being grown in Canada for medical purposes. As of April 2018, there was 97 authorized licensed producers and more than 200,000 registered clients, making C. sativa an economically important crop in Canada (Government of Canada 2018). Symptoms of powdery mildew were observed on indoor-grown plants in production facilities in Atlantic Canada and British Columbia. Powdery mildew was present in all production sites sampled between 2013 and 2017, and ranged in incidence from 20 to 35%. Symptoms appeared as white circular patches consisting of epiphytic mycelia and conidia on the adaxial leaf surface. As the disease progressed, the mycelia, conidiophores and conidia covered the entire surface of the leaves and spread to flower bracts and buds. The conidiophores were unbranched, cylindrical, measuring 140-260 µm in height and erected singly from mycelium. Conidiophores produced between one and four conidia in chains
Pathogens and Molds Affecting Production and Quality of Cannabis sativa L.
Zamir K. Punja, Danielle Collyer, Cameron Scott, Samantha Lung, Janesse Holmes and Darren Sutton
Frontiers in Plant Science Vol 10, October 2019
doi: 10.3389/fpls.2019.01120
Plant pathogens infecting marijuana (Cannabis sativa L.) plants reduce growth of the crop by affecting the roots, crown, and foliage. In addition, fungi (molds) that colonize the inflorescences (buds) during development or after harvest, and which colonize internal tissues as endophytes, can reduce product quality. The pathogens and molds that affect C. sativa grown hydroponically indoors (in environmentally controlled growth rooms and greenhouses) and field-grown plants were studied over multiple years of sampling. A PCRbased assay using primers for the internal transcribed spacer region (ITS) of ribosomal DNA confirmed identity of the cultures. Root-infecting pathogens included Fusarium oxysporum, Fusarium solani, Fusarium brachygibbosum, Pythium dissotocum, Pythium myriotylum, and Pythium aphanidermatum, which caused root browning, discoloration of the crown and pith tissues, stunting and yellowing of plants, and in some instances, plant death. On the foliage, powdery mildew, caused by Golovinomyces cichoracearum, was the major pathogen observed. On inflorescences, Penicillium bud rot (caused by Penicillium olsonii and Penicillium copticola), Botrytis bud rot (Botrytis cinerea), and Fusarium bud rot (F. solani, F. oxysporum) were present to varying extents. Endophytic fungi present in crown, stem, and petiole tissues included soil-colonizing and cellulolytic fungi, such as species of Chaetomium, Trametes, Trichoderma, Penicillium, and Fusarium. Analysis of air samples in indoor growing environments revealed that species of Penicillium, Cladosporium, Aspergillus, Fusarium, Beauveria, and Trichoderma were present. The latter two species were the result of the application of biocontrol products for control of insects and diseases, respectively. Fungal communities present in unpasteurized coconut (coco) fiber growing medium are potential sources of mold contamination on cannabis plants. Swabs taken from greenhouse-grown and indoor buds pre- and post-harvest revealed the presence of Cladosporium and up to five species of Penicillium, as well as low levels of Alternaria species. Mechanical trimming of buds caused an increase in the frequency of Penicillium species, presumably by providing entry points through wounds or spreading endophytes from pith tissues. Aerial distribution of pathogen inoculum and mold spores and dissemination through vegetative propagation are important methods of spread, and entry through wound sites on roots, stems, and bud tissues facilitates pathogen establishment on cannabis plants.
Pythium Root Rot Control in Seedlings and Cuttings Starts with Prevention
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/pythium-root-rot.html
Pythium spp.
Industrial hemp (Cannabis sativa x indica) in Kentucky is grown both outdoors and in greenhouses. Under wet soil conditions in either system, Pythium root rot and damping off diseases pose threats to seedlings, cuttings, and young plants. Indoor-grown hemp is most often infected, however.
Pythium root rot and damping off are caused by several species of Pythium, a water mold pathogen. Pythium are soilborne, fungus-like oomycetes. The term water mold is often used because these pathogens require free water in order to complete their life cycles (reproduce and spread from plant to plant). Under wet conditions such as rain or irrigation, propagules (particularly swimming zoospores) increase dramatically, disseminate to healthy roots, and infect. Disease often develops within a week or two after infection.
Root rot and lower stem decay cause above-ground symptoms such as marginal leaf scorch, stunting, poor vigor, and/or inconsistent stands. These symptoms are the result of lack of water and nutrient uptake as root and vascular tissue is damaged. Disease is more severe under wet soil conditions, high soluble salts, and plant stress.
Hemp Field Sanitation for Small-Scale Plantings
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/sanita...ield-hemp.html
IMPORTANCE OF SANITATION
Although hemp is considered a disease-free plant, it is unknown whether levels of certain pathogens can build up to problematic levels. If diseases become a significant problem in field-planted hemp, results can include premature leaf drop, bud decay, dieback, decline, and even plant death. When diseases do occur, it is often presumed that fungicides are the most important and effective disease management tools available. However, there are limited fungicides available for use in hemp. Thus, a good sanitation program can help reduce the need for chemical controls and can improve the effectiveness of other practices for managing disease. This often-overlooked disease management tool reduces pathogen numbers and eliminates infective propagules (inoculum such as fungal spores and survival structures) that cause disease.
For example, certain fungal and water molds can become prevalent during rainy or humid growing seasons. When disease management is neglected, pathogen populations build-up and continue to increase as long as there is susceptible plant tissue available for infection and disease development. Infected plant tissue, infested soil, and pathogen propagules all serve as sources of pathogens that can later infect healthy plants.
Reduction of pathogens by various sanitation practices can reduce both active and dormant pathogens. While actively growing plants can provide host tissue for pathogen multiplication, dead plant material (diseased foliage, stems, and/or roots) can harbor overwintering propagules for months or years. These propagules can travel via air/wind currents, stick to shoes or tools, or move with contaminated soil or water droplets. Thus, prevention of spread of pathogens to healthy plants and the elimination of any disease-causing organisms from one season to another are the foundations for a disease management program using sanitation practices.
Hemp Greenhouse Sanitation
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/sanita...ouse-hemp.html
Diseases are a major concern for greenhouse growers and can be a key limitation to profitable plant production. Disease management in greenhouses is critical because the warm, humid environment in these structures provides optimal conditions for reproduction of many pathogens. When disease management is neglected, pathogen populations build-up and continue to increase as long as there is susceptible plant tissue available for infection and disease development. Infected plant tissue, infested soil, and pathogen inoculum (such as spores and survival structures) all serve as sources of pathogens that can later infect healthy plants.
Koppert Pest Control Guidelines
Ask me for info
Larvicidal Action of Cannabidiol Oil and Neem Oil against Three Stored Product Insect Pests: Effect on Survival Time and in Progeny.
Mantzoukas, S., Ntoukas, A., Lagogiannis, I., Kalyvas, N., Eliopoulos, P., & Poulas, K.
Biology, 9(10), 321.(2020).
doi:10.3390/biology9100321
Stored product pests can be detrimental to agricultural produce. As much as chemical pesticides are effective control agents, they involve several environmental and health risks. Within the framework of studies on alternative pest management methods, interest has focused on a plethora of plants whose extracts have demonstrated promising action as insecticides. Azadirachta indica and the derived neem oil have been extensively tested against many harmful insect species. In contrast, Cannabis sativa L. and its main compound, CBD, a highly concentrated cannabinoid, have not been investigated much. The present study examined the potential insecticidal activity of CBD and neem oils against 4th instar larvae of Tribolium confusum, Oryzaephilus surinamensis and Plodia interpunctella on wheat, rice and corn seeds. Treatment efficacy was expressed in terms of larval mortality. Mortality was observed in relation to dosage, time exposure intervals and product types. The results showed clear pesticidal activity for both oils, which at high doses induced significant mortality. The treatments produced significantly fewer offspring in the insect species tested than the control. The efficacy of treatment in progeny suppression was, as expected, dose dependent.
LEGAL PEST MANAGEMENT PRACTICES FOR CANNABIS GROWERS IN CALIFORNIA
Department of Pesticide Regulation
https://www.cdpr.ca.gov/docs/county/...attach1502.pdf
PESTS OF CANNABIS IN CALIFORNIA
Cannabis pests vary according to cultivar (variety), whether the plants are grown indoors or outdoors, and where the plants are grown geographically. The pests included in this review are preliminary and based on the following sources: a presentation given in 2013 by
Whitney Cranshaw, an extension entomologist at Colorado State University, and a review article by John M. McPartland, a professor of family medicine at the University of Vermont. We also received input from Kevin Hoffman, Primary State Entomologist, California
Department of Food & Agriculture (CDFA).
Lettuce Chlorosis Virus Disease: A New Threat to Cannabis Production
August 2019 Viruses 11(9):802
DOI: 10.3390/v11090802
Lab: Aviv Dombrovsky's Lab
Hadad, Neta Luria, Smith, Aviv Dombrovsky
In a survey conducted in Cannabis sativa L. (cannabis) authorized farms in Israel, plants showed disease symptoms characteristic of nutrition deprivation. Interveinal chlorosis, brittleness, and occasional necrosis were observed in older leaves. Next generation sequencing analysis of RNA extracted from symptomatic leaves revealed the presence of lettuce chlorosis virus (LCV), a crinivirus that belongs to the Closteroviridae family. The complete viral genome sequence was obtained using RT-PCR and Rapid Amplification of cDNA Ends (RACE) PCR followed by Sanger sequencing. The two LCV RNA genome segments shared 85–99% nucleotide sequence identity with LCV isolates from GenBank database. The whitefly Bemisia tabaci Middle Eastern Asia Minor1 (MEAM1) biotype transmitted the disease from symptomatic cannabis plants to un-infected ‘healthy’ cannabis, Lactuca sativa, and Catharanthus roseus plants. Shoots from symptomatic cannabis plants, used for plant propagation, constituted a primary inoculum of the disease. To the best of our knowledge, this is the first report of cannabis plant disease caused by LCV.
Longhorn Beetles and Botryosphaeria
John McPartland, Karl Hillig
November 2007 Journal of Industrial Hemp 12(2):123-133
DOI: 10.1300/J237v12n02_09
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The hemp longhorn beetle (Thyestilla gebleri) damages
hemp stalks in eastern Asia. The fungus Botryosphaeria marconii causes stalk and twig blight disease of hemp in North America and perhaps western Europe. The life cycles of the beetle and fungus overlap on host plants; if their geographic ranges also overlapped they would likely cause synergistic damage–an epidemic waiting to happen?
Marijuana (Cannabis sativa) toxicosis in cattle
David Driemeier
Veterinary and human toxicology · January 1998
4 of 5 cattle died after consuming bales of dried marijuana leaves.
https://www.researchgate.net/publica...osis_in_cattle
Microbial Contaminants in Cannabis: What are the Dangers?
Reginald Gaudino, Steep Hill July 13, 2018
https://800ezmicro.com/cannabis-test...e-dangers.html
Unless cannabis is grown in a clean room with appropriate air ?ltration and other good growing and laboratory practices, it is inevitable that these microorganisms will be found on cannabis ?owers and products made with them. Most microorganisms do not present a problem at low levels, though some pathogenic microorganisms are harmful even at low levels because they produce toxins that cause a variety of symptoms: from allergy-like symptoms to various types of cancer.
Other microorganisms are harmful at mid to higher levels of contamination, particularly if they are inhaled. Immunocompromised patients including those receiving chemotherapy are at a higher level of risk to all microorganisms, where even low levels of microbial contamination can lead to fatality. Contaminated medical cannabis and incidence of diseases such as Aspergillus nodulosis (a disease caused by the inhalation of Aspergillus niger) has already been noted (1).
Microbiological examination of nonsterile Cannabis products: Molecular Microbial Enumeration Tests and the limitation of Colony Forming Units.
Kevin McKernan, Yvonne Helbert, Heather Ebling, Adam Cox, Liam T. Kane, Lei Zhang
https://osf.io/vpxe5/download
Cannabis microbial testing presents unique challenges. Unlike food testing, cannabis testing has to consider various routes of administration beyond just oral administration. Cannabis flowers produce high concentrations of antimicrobial cannabinoids and terpenoids and thus represent a different matrix than traditional foods. In 2018, it is estimated that 50% of cannabis is consumed via vaporizing or smoking oils and flowers while the other half is consumed in Marijuana Infused Products or MIPs. There are also transdermal patches, salves and suppositories that all present different microbial considerations. Several recent publications have surveyed cannabis flower microbiological communities. These have detected several concerning genus and species such as Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Penicillium paxilli and Penicillium citrinum, Clostridium botulinum, Eschericia coli, Salmonella and Staphyloccus. There are several documented cannabis complications and even fatalities due to Aspergillosis in immuno-compromised patients. A recent paper even demonstrates a case of cannabis derived Aspergillosis in an immune competent patient.
Microbiological Safety Testing of Cannabis
Cannabis Safety Institute May 2015
Mowgli Holmes, Jatin M. Vyas, William Steinbach, John McPartland
https://cannabissafetyinstitute.org/...f-Cannabis.pdf
Cannabis is increasingly becoming legal at the state level in the U.S., for either medical or recreational use. Each of these states has had to wrestle with the question of how to ensure the safety of a new product that is not covered under any existing safety guidelines. Safety testing in other agricultural industries is regulated by the FDA, the USDA, or by other federal agencies, all of which have been unable to assist the states in this case. The few states that have produced safety testing guidelines for Cannabis were forced to develop them from scratch, without the regulatory and scientific support that federal agencies typically provide. In the absence of this federal guidance, regulators in each state have turned to different sources for information, and each state has produced a unique set of rules and regulations (if they have produced one at all). Many of these are in outright conflict with each other, and they are largely not grounded on scientific research. This whitepaper is focused entirely on the question of microbiological safety, and has been written in order to promote the adoption of regulatory guidelines for the Cannabis industry that are rational, consistent, and safe. We have gathered what data there are on this issue and related ones, and assembled a broad collection of experts on the general subjects of plant microbiology, medical microbiology, and safety-testing of agricultural and food products.
Microbiological study and quantification cannabinoids cannabis samples catalonia cscs
Fundación CANNA
https://www.fundacion-canna.es/en/mi...catalonia-cscs
In 2014, Fundación CANNA has carried out a study in which 55 Cannabis samples from 31 social Cannabis clubs from Catalonia were analysed. The aim was to learn about microorganisms that could appear and give information about the average potency of the Cannabis dispensed. The results were shown in the scientific park of the University of Catalonia in October.
Microbiological study of Cannabis samples
Fundación CANNA
https://www.fundacion-canna.es/en/mi...nnabis-samples
Cannabis, like any other plant or food, can contain microbiological contaminants potentially harmful for our health. These contaminants are some types of bacteria and fungi that could end up appearing or developing in the final product. It will depend on the growing, drying, processing, preservation and handling of the plant.
Samples from several clubs from Cataluña were analysed in the laboratory. A total of 55 samples from 31 CSC.
In order to determine the microbiological level of the samples analysed, two factors have been taken into account: the total number of microorganisms present in each sample, and the absence of microorganisms with high pathogenic potential. A high number of microorganisms, irrespective of the kind of microorganism, indicates that the production, preservation and/or handling processes haven't been properly managed. Nowadays, some US states are establishing microbiological limits for the Cannabis provided in their dispensaries.
Microbiological Testing of Cannabis and Derived Products
Microbiology International
https://800ezmicro.com/cannabis-testing.html
Cannabis samples are typically received in the testing laboratory as the flower, topical emulsions & concentrated oils, or edible preparations.
Weighing and Diluting Flower and edibles are processed at a dilution factor of 1:9 or 1:99. Topical emulsions and oils are processed at a ratio of 1:99 or 1:9 with the addition of a surfactant/detergent.
Sample enrichment: Take the guesswork out of weighing and diluting by pairing the EZ-Flow gravimetric diluter and MediaBox ready-to-use sterile broths. Based on the weight of your sample, the EZ-Flow will automatically create the correct dilution factor by drawing liquid media directly from MediaBox and dispensing it into your sample bag. MediaBox connects directly to the EZ-Flow diluter for a completely closed system. The EZ-Flow has a dilution range factor from 1/2 to 1/99. Enrichment broth types: Buffered Peptone Water (BPW), Butterfields Phosphate Buffer, Tryptic Soy Broth with Casamino acids and 8mg/L Novobiocin (mTSB+n), Nutrient Broth, Letheen Broth with Tween 80, and 0.1% BPW. Custom formulations available.
Not Cannabis Specific
Mildew control with CleanLight technology
https://cleanlight.nl/wp-content/upl...March-2012.pdf
In September 2010, Horticultural News dedicated a few pages to the introduction of an exciting new crop protection technology in East Africa. It is a technology, not based on chemicals, but based on the use of cleansing light.
Mitochondrial COI Sequence Variations within and among Geographic Samples of the Hemp Pest Psylliodes attenuata from China.
Guo, L., Gao, F., Cheng, Y., Gao, C., Chen, J., Li, Z., … Xu, J.
Insects, 11(6), 370.(2020).
doi:10.3390/insects11060370
The hemp flea beetle Psylliodes attenuata (Coleoptera: Chrysomelidae: Psylliodes) is a common pest of Cannabis sativa, including cultivars of both industrial hemp and medicinal marijuana. Both the larval and adult stages of this beetle can cause significant damages to C. sativa, resulting in substantial crop losses. At present, little is known about the populations of this pest, including its genetic diversity. In this study, we obtained 281 P. attenuata samples from nine field sites representing broad industrial hemp productions in China and analyzed their DNA sequences at the mitochondrial COI gene, the insect DNA barcode. Our analyses revealed a total of 48 haplotypes, with 28 being found only in one specimen each while the remaining 20 were shared by two or more specimens each. Of the 20 shared haplotypes, eight were shared among local populations often from far away locations, consistent with recent long-distance dispersals. However, the observed putative long-distance dispersals have not obscured the significant genetic differentiations among the regional populations from northeastern, eastern, central and southwestern China. Interestingly, haplotype network analyses suggest evidence for potential mitochondrial recombination in natural populations of this species. We briefly discuss the implications of our results on its evolution, center of diversity, route of spread, and pest management strategies in hemp fields.
Molecular characterization of Aster yellows (16SrI) group phytoplasma infecting Cannabis sativa in eastern Uttar Pradesh
SMRITI MALLÅ, G.P. RAO and P.P. UPADHYAYA
Indian Phytopath. 64 (1) : 75-77 (2011)
During survey of diseases of weeds in and around agricultural fields in eastern UP in 2008, non-specific yellowing, chlorosis of leaves, proliferation of axillary shoots and witches’-broom symptoms on Cannabis sativa plants followed by death of entire plants were recorded. Suspected infected and healthy tissues of C. sativa from different locations at Gorakhpur in eastern UP, India, were examined by nested PCR assay using universal phytoplasma primers P1/P6 and R16F2n/R16R2. C. sativa plant with non-specific yellowing and witches’-broom symptoms yielded phytoplasma-exclusive DNA bands of 1.2 kb when nested PCR was performed. BLAST search analysis of the 16S rRNA sequence of the C. sativa phytoplasma shared 99%
identity with those of phytoplasma members of 16SrI group, ‘Candidatus Phytoplasma asteris’. Therefore, the C. sativa phytoplasma under present study was identified as a member of the 16SrI group.
Molecular characterization, vector identification and sources of phytoplasmas associated with brinjal little leaf disease in India
Manish Kumar, Madhupriya, Govind Pratap Rao,
3 Biotech (2017) 7:7
DOI 10.1007/s13205-017-0616-x
Brinjal little leaf (BLL) is a widespread disease of phytoplasma etiology in India that induces severe economic losses. Surveys were conducted in eight brinjalgrowing states of India during July 2014 to September 2015 and eighteen BLL samples showing little leaf, phyllody and witches’ broom symptoms were collected for phytoplasma identification. Presence of phytoplasmas was confirmed in all the eighteen BLL samples using polymerase chain reaction with phytoplasma-specific primer pairs (P1/P6, R16F2n/R16R2). Pair wise sequence comparison and phylogenetic relationship of 16S rRNA gene sequences of BLL phytoplasma strains confirmed that sixteen out of eighteen BLL strains belonged to clover proliferation phytoplasma (16SrVI) group and two BLL strains (GKP-A and GKP-B) from Gorakhpur, Uttar Pradesh, were classified under 16SrII group. Further virtual RFLP analysis of 16S rDNA sequences allowed finer classification of BLL strains into 16SrII-D and 16SrVI-D subgroups. BLL phytoplasma strains belonging to 16SrVID subgroup were found as the most widespread phytoplasma strains associated with BLL disease in India. 16SrVI-D subgroup phytoplasma association with two symptomatic weed species viz. Cannabis sativa subsp. sativa at Noida, Uttar Pradesh and Portulaca oleracea at IARI fields, New Delhi was also confirmed by nested PCR assays with similar set of phytoplasma-specific primers, pairwise 16S rDNA sequence comparison, phylogeny and virtual RFLP analysis. Out of five identified leafhopper species from BLL-infected fields at Noida, Uttar Pradesh and Delhi, only Hishimonas phycitis was identified as carrier and natural vector of 16SrVI-D subgroup of phytoplasmas by nested PCR assays, sequence comparison, phylogeny, virtual RFLP analysis and transmission assays.
NOT CANNABIS SPECIFIC but many of the viruses are found in cannabis
Molecular variation of viruses infecting hops in Australia and associated studies
October 2010
Damian R CrowleDamian R Crowle
https://www.researchgate.net/publica...ciated_studies
The objectives of this study were to investigate the virus incidence and molecular variation of Apple mosaic virus (ApMV), Hop mosaic virus (HpMV) and Hop latent virus (HpLV) and to examine the Hop latent viroid (HLVd) infection status of Australian hop varieties.
HLVd was found to be ubiquitous in all hop gardens surveyed. This was the first survey of HLVd in Australia. This confirms findings in the Czech Republic where infection was also found to be ubiquitous, while viroid status in other countries also indicates high levels of infection.
A virus survey, primarily to collect viruses for use in molecular analysis, was conducted. The percentage of infected plants detected in this study correlates with those previously undertaken by Pethybridge et al., 2000b. Cultivar ‘Victoria’ had the greatest level of ilarvirus infections (61%) significantly more than ‘Super Pride’ (6%). Cultivar Opal had the greatest incidence of carlavirus infections (38%) but this was not significantly different to other cultivars sampled. Hops from the farm at Bushy Park recorded the highest incidences of Ilarvirus infection (44%) although this was not significantly different to the other sampled farms. However, hops sampled from the Gunns Plains farm showed significantly more carlavirus infections (40%) than the other three sampled farms. Experiments testing transmission capacity of local aphid species (Macrosiphum euphorbiae and Myzus persicae) of the carlaviruses HpMV and HpLV was performed. It was found that both aphid species transmitted both carlaviruses, this being the first study to demonstrate transmission of HpLV by an aphid other than the hop aphid, Phorodon humuli. This study also showed that prior infection by either virus did not significantly affect subsequent the efficiency of transmission of the other which may have explained observations of greater than expected coinfection of both carlaviruses within the field. It was known that two serologically distinct ilarvirus strains infect hop. Prior literature indicated that these were strains of Prunus necrotic ringspot virus (PNRSV) designated –intermediate (PNRSV-I) type and PNRSV-A (apple serotype). This study undertook molecular analysis of hop-infecting ilarviruses to clarify strain diversity and taxonomic relationships. Analyses showed Australian hops are infected with two distinct strains of ApMV (and not PNRSV) these being distinct to ApMV strain commonly found in Apple. It was proposed that hop infecting strains of ilarvirus be termed ApMV-Hop (the former PNRSV-apple serotype) and ApMV-Intermediate (the former PNRSV intermediate serotype). PCR based assays were developed that could be used to distinguish the two strain types.
Suggestions of strains of HpMV had been described due to lethal and non-lethal response following infection in ‘English Golding’ hops. Molecular analysis of HpMV from Australian hop gardens indicated that there were at least two distinct clades of HpMV present with approximately 80% homology. Further work conducted at the conclusion of this study identified a possible third clade of HpMV. All HpLV isolates that were sequenced in this study had a high degree of identity. This was supported by recent publication of several further sequences on GenBank that also show this high degree of identity.
Multiplex qPCR and Cannabis Microbiome sequencing reveals several Bacteria and Fungi Native to Cannabis flowers
Kevin McKernan, Jessica Spangler, Lei Zhang, Vasisht Tadigotla, Yvonne Helbert, Douglas Smith
Color Poster:
https://system.na3.netsuite.com/core...7c1f3&_xt=.pdf
PDF:
https://www.medicinalgenomics.com/wp...owers_sbmt.pdf
New Hemp Diseases and Pests in New Zealand
John McPartland, Birgit Rhode
June 2005 Journal of Industrial Hemp 10(1):99-108
DOI: 10.1300/J237v10n01_08
This article continues the “Cannabis clinic” series, presenting diseases and pests of hemp (Cannabis sativa L.), featuring color illustrations of signs and symptoms. Hemp cultivation is new to New Zealand (NZ). Field trials began in 2001, evaluating cultivars from Europe or North America. Novel crop plants imported into new geographical areas are exposed to new diseases and pests. The imported plants often present less resistance to local problems than do indigenous plants. Many ‘local’ problems in NZ, however, are introduced organisms. Non-native birds cause the greatest crop damage. Rabbits, famous aliens in NZ, also cause problems. Invertebrate pests include the brown garden snail (Helix aspersa), brown field slug (Deroceras panormitanum), orange-soled slug (Arion distinctus), budworm (Helicoverpa armigera), passion vine leaf hopper (Scolypopa australis), caterpillars (Epiphyas postvittana), and melon aphid (Aphis gossypii). The latter species may be the vector of an unidentified virus that infests hemp. In humid regions and wet conditions, the fungi Botrytis cinerea, Trichothecium roseum, and Sclerotinia sclerotiorum rot flowering tops and stalks. For this article, image capture of invertebrate pests and fungi utilized Auto Montage software, to improve the depth of field and produce perfectly focused images.
New species, combinations, host associations and location records of fungi associated with hemp (Cannabis sativa)
July 1997 Mycological Research 101(7):853-857
DOI: 10.1017/S0953756297003584
John McPartland, Marc A. Cubeta
Micropeltopsis cannabis sp. nov. and Orbilia luteola (Roum.) comb. nov. are proposed. New Cannabis host associations include binucleate Rhizoctonia spp., Curvularia cymbopogonis, Sphaerotheca macularis, Glomus mosseae, and Pestalotiopsis sp. The geographic ranges of Pseudoperonspora cannabina, Septoria neocannabina and Fusarium graminearum are expanded.
Not the one, but the only one: about Cannabis cryptic virus in plants showing “hemp streak” disease symptoms.
Righetti, L., Paris, R., Ratti, C., Calassanzio, M., Onofri, C., Calzolari, D., … Grassi, G.
European Journal of Plant Pathology, 150(3), 575–588. (2017).
doi:10.1007/s10658-017-1301-y
Interveinal chlorosis and leaf margin wrinkling are widespread symptoms of Cannabis sativa. They are traditionally attributed to the so-called hemp streak virus (HSV), but its existence has not been demonstrated yet. To our knowledge, no molecular investigation has so far been performed in order to identify the causal agent of this symptomatology, we therefore decided to use traditional and molecular virology techniques to better characterize symptoms and pursue the etiological agent. No pathogenic virus was found by using targeted PCR reactions and by RNA sequencing, whereas we were able to detect the Cannabis cryptic virus (CanCV) with both techniques. We, therefore, developed an RT-qPCR assay based on a CanCVspecific TaqMan probe and applied it to a wide range of symptomatic and symptomless plants, using a twostep (for quantification), or a one-step (for fast detection) protocol. Both symptoms and the virus were only shown to be transmitted vertically and did not pass via mechanical inoculation or grafting, though we could not find any cause-effect correlation between them. In fact, the virus was found in all the tested hemp samples, and its abundance varied greatly between different accessions and individuals, independently from the presence and severity of symptoms. The suggestion that hemp streak is caused by a virus is therefore questioned. Some abiotic stresses seem to play a role in triggering the symptoms but this aspect needs further investigation. For breeding purposes, a selection of parental plants based on the absence of symptoms proved to be efficient in containment of the disease.
Pathogens and Molds Affecting Production and Quality of Cannabis sativa L.
Zamir K. Punja, Danielle Collyer, Cameron Scott, Samantha Lung, Janesse Holmes and Darren Sutton
Frontiers in Plant Science Vol 10, October 2019
doi: 10.3389/fpls.2019.01120
Plant pathogens infecting marijuana (Cannabis sativa L.) plants reduce growth of the crop by affecting the roots, crown, and foliage. In addition, fungi (molds) that colonize the inflorescences (buds) during development or after harvest, and which colonize internal tissues as endophytes, can reduce product quality. The pathogens and molds that affect C. sativa grown hydroponically indoors (in environmentally controlled growth rooms and greenhouses) and field-grown plants were studied over multiple years of sampling. A PCRbased assay using primers for the internal transcribed spacer region (ITS) of ribosomal DNA confirmed identity of the cultures. Root-infecting pathogens included Fusarium oxysporum, Fusarium solani, Fusarium brachygibbosum, Pythium dissotocum, Pythium myriotylum, and Pythium aphanidermatum, which caused root browning, discoloration of the crown and pith tissues, stunting and yellowing of plants, and in some instances, plant death. On the foliage, powdery mildew, caused by Golovinomyces cichoracearum, was the major pathogen observed. On inflorescences, Penicillium bud rot (caused by Penicillium olsonii and Penicillium copticola), Botrytis bud rot (Botrytis cinerea), and Fusarium bud rot (F. solani, F. oxysporum) were present to varying extents. Endophytic fungi present in crown, stem, and petiole tissues included soil-colonizing and cellulolytic fungi, such as species of Chaetomium, Trametes, Trichoderma, Penicillium, and Fusarium. Analysis of air samples in indoor growing environments revealed that species of Penicillium, Cladosporium, Aspergillus, Fusarium, Beauveria, and Trichoderma were present. The latter two species were the result of the application of biocontrol products for control of insects and diseases, respectively. Fungal communities present in unpasteurized coconut (coco) fiber growing medium are potential sources of mold contamination on cannabis plants. Swabs taken from greenhouse-grown and indoor buds pre- and post-harvest revealed the presence of Cladosporium and up to five species of Penicillium, as well as low levels of Alternaria species. Mechanical trimming of buds caused an increase in the frequency of Penicillium species, presumably by providing entry points through wounds or spreading endophytes from pith tissues. Aerial distribution of pathogen inoculum and mold spores and dissemination through vegetative propagation are important methods of spread, and entry through wound sites on roots, stems, and bud tissues facilitates pathogen establishment on cannabis plants.
PATS Indoor Drone Solutions
Pulone Sabina, Terpenes and Testing Magazine
https://terpenesandtesting.com/pats-...one-solutions/
Pests control in crops can be a laborious and difficult task, often involving the use of chemicals which can leave residues in the final product. Pesticides are a great concern on human health due to their toxic nature, persistency, lipophilicity, and bioaccumulation. Monitoring insect populations can help reducing the quantities of pesticide treatments and limiting the concentrations of harmful chemicals. What if we exploit modern technology to keep track of insect offspring and to mechanically eliminate harmful insect species?
PATS Indoor Drone Solutions offers an innovative method to control insect spreading and to selectively get rid of flying pests. By using drones, the monitoring and prevention of harmful species in crops is less time consuming than employees scouting activities. Additionally, tracking pest populations can be more accurate, leading to less pesticide treatments or avoiding them all together by eradicating harmful pests with the drone itself.
Pesticide Use on Cannabis
RodgerVoelker, Mowgli Holmes
Cannabis Safety Institute June 2015
https://cannabissafetyinstitute.org/...hite-Paper.pdf
Legalized cannabis production is a rapidly growing agricultural industry. However, given that cannabis production has developed and operated in an Unregulated setting various practices have been adopted that are at odds with accepted regulations regarding human safety and environmental impacts. Chief amongst these is the unregulated use of pesticides, which has potentially serious public health and environmental consequences. In the absence of guidance from the Environmental Protection Agency on this subject, it is critical that state regulators enact programs to protect workers, the environment, and Cannabis consumers. This paper presents data indicating that pesticide use is widespread in the Cannabis Industry, and that pesticide residue on retail Cannabis products is often found at levels exceeding the allowable levels on any agricultural product. In addition, a set of basic recommendations is presented that will allow states to move forward safely until more detailed Cannabis-°©?specific pesticide data is a
Phorodon cannabis Passerini (Hemiptera: Aphididae), a newly recognized pest in North America found on industrial hemp
Whitney S. Cranshaw, Susan Halbert, Colin Favret, Gary L. Miller,
September 2018 Insecta Mundi 662:1-12
https://theowl.fsu.edu/mundi/article/view/0662/102363
Phorodon cannabis Passerini (Hemiptera: Aphididae: Macrosiphini) is reported for the first time as a pest of Cannabis L. crops in North America. The insect has been confirmed from fields of industrial hemp in Colorado and Virginia and has been found present within greenhouses in at least several American states and one Canadian province. The generic position of the aphid species is discussed and other known members of the genus are ruled out. Phorodon cannabis is placed in genus Phorodon Passerini and subgenus (Diphorodon Börner). Phorodon persifoliae Shinji is transferred to Hyalopterus Koch as a nomen dubium.
Plant-feeding phlebotomine sand flies, vectors of leishmaniasis, prefer Cannabis sativa
Ibrahim Abbasia, Artur Trancoso Lopo de Queirozb, Oscar David Kirsteina, Abdelmajeed Nasereddinc, Ben Zion Horwitza, Asrat Hailud, Ikram Salahe, Tiago Feitosa Motab, Deborah Bittencourt Mothé Fragab, Patricia Sampaio Tavares Verasb, David Pochef, Richard Pochef, Aidyn Yeszhanovg, Cláudia Brodskynb, Zaria Torres-Pochef, and Alon Warburg
PNAS | November 13, 2018 | vol. 115 | no. 46, 11790–11795
DOI: 10.1073/pnas.1810435115
Blood-sucking phlebotomine sand flies (Diptera: Psychodidae) transmit leishmaniasis as well as arboviral diseases and bartonellosis. Sand fly females become infected with Leishmania parasites and
transmit them while imbibing vertebrates’ blood, required as a source of protein for maturation of eggs. In addition, both females and males consume plant-derived sugar meals as a source of energy. Plant meals may comprise sugary solutions such as nectar or honeydew (secreted by plant-sucking homopteran insects), as well as phloem sap that sand flies obtain by piercing leaves and stems with their needle-like mouthparts. Hence, the structure of plant communities can influence the distribution and epidemiology of leishmaniasis. We designed a nextgeneration sequencing (NGS)–based assay for determining the source of sand fly plant meals, based upon the chloroplast DNA gene ribulose bisphosphate carboxylase large chain (rbcL). Here, we report on the predilection of several sand fly species, vectors of leishmaniasis in different parts of the world, for feeding on Cannabis sativa. We infer this preference based on the substantial percentage of sand flies that had fed on C. sativa plants despite the apparent “absence” of these plants from most of the field sites. We discuss the conceivable implications of the affinity of sand flies for C. sativa on their vectorial
capacity for Leishmania and the putative exploitation of their attraction to C. sativa for the control of sand fly-borne diseases
NOT CANNABIS SPECIFIC
Points to Consider in Prevention of Crown Gall
Janine Hasey, Daniel A. Kluepfel & Lani Yakabe
https://www.sacvalleyorchards.com/wa...ng-crown-gall/
Pre-plant fumigation
Long-term Agrobacterium survival
Contaminated grafting tools and graft wood
Host Resistance
Overall Prevention Strategy
These Crown Gall management “Points to Consider” are based on experimental laboratory, greenhouse and /or field research and observations. For answers to your crown gall prevention questions, consult your local UCCE Farm Advisor.
Pseudomonas cannabina pv. cannabina pv. nov., and Pseudomonas cannabina pv. alisalensis (Cintas Koike and Bull, 2000) comb. nov., are members of the emended species Pseudomonas cannabina (ex ?Sutic? & Dowson1959) Gardan, Shafik, Belouin,Brosch, Grimont & Grimont 1999
Carolee T. Bull, Charles Manceau, John Lydon, Hyesuk Kong, Boris A.Vinatzer, Marion Fischer-LeSaux
Systematic and Applied Microbiology 33 (2010) 105–115
doi:10.1016/j.syapm.2010.02.001
Sequence similarity in the 16S rDNA gene confirmed that crucifer pathogen Pseudomonas syringae pv. alisalensis belongs to P. syringae sensu lato. In reciprocal DNA/DNA hybridization experiments, DNA relatedness was high (69–100%) between P. syringae pv. alisalensis strains and the type strain of P. cannabina (genomospecies 9). In contrast, DNA relatedness was low (below 48%) between P. syringae pv. alisalensis and reference strains from the remaining genomospecies of P. syringae including the type strain of P. syringae and reference strain of genomospecies 3 (P. syringae pv. tomato) although the wellknown crucifer pathogen, P. syringae pv. maculicola, also belongs to genomospecies 3. Additional evidence that P. syringae pv. alisalensis belongs to P. cannabina was sequence similarity in five gene fragments used in multilocus sequence typing, as well as similar rep-PCR patterns when using the BOXA1R primers. The description of P. cannabina has been emended to include P. syringae pv. alisalensis. Host range testing demonstrated that P. syringae pv. alisalensis strains, originally isolated from broccoli, broccoli raab or arugula, were not pathogenic on Cannabis sativa (family Cannabinaceae). Additionally, P. cannabina strains, originally isolated from the C. sativa were not pathogenic on broccoli raab or oat while P. syringae pv. alisalensis strains were pathogenic on these hosts. Distinct host ranges for these two groups indicate that P. cannabina emend. consists of at least two distinct pathovars, P. cannabina pv. cannabina pv. nov., and P. cannabina pv. alisalensis comb. nov. Pseudomonas syringae pv. maculicola strain CFBP 1637 is a member of P. cannabina
PYTHIUM APHANIDERMATUM CROWN ROT OF INDUSTRIAL HEMP
Jennifer Schoener, Russ Wilhelm and Shouhua Wang,
NPDN News Volume 12 Issue 9 2
https://www.npdn.org/system/files/NPDN_September-17.pdf
Cultivation of industrial hemp (Cannabis sativa) was first approved in 2014 for the purpose of research and development. The Federal Farm Bill Section 7606 authorizes state agencies to conduct pilot trials on the crop to assess crop viability for the creation of an industry in prospective states. In Nevada, the Department of Agriculture authorizes the production of hemp crops for research purposes. The acreage of hemp production in Nevada is relatively small in comparison to the acreage in other states. However, plant diseases associated with hemp crops have been occurring in Nevada in recent years. In 2016, the Nevada Department of Agriculture Plant Pathology Lab detected Fusarium root rot and sudden death disease from an industrial hemp crop, and Fusarium wilt from medical marijuana plants. Here we describe a newly detected hemp disease: Pythium aphanidermatum crown rot. Pythium aphanidermatum crown rot occurred in a commercial hemp field, with approximately 5-10 percent of plants affected. Infected plants were noticed by leaf yellowing, curling, necrosis, and the eventual death of entire plants (Fig A). White-colored mold (Pythium mycelium) growth on the surface of the crown area was frequently observed when the plant was pulled from the ground (Fig D). Close examination of the stalk revealed extensive water-soaked lesions and cankers around the crown and basal stalk regions (Fig C). With disease progression, the majority of stalks became completely necrotic or rotted (Fig F). Some affected plants had mild root rot. In the early stage of the disease, only mild internal discoloration of the basal stalk tissue was observed (Fig B). In later stages, cankers spread from the crown area to lower branched stems (Fig E). Affected tissue plated on potato dextrose agar (PDA) medium amended with streptomycin did not yield growth of any pathogens. On selective PARP medium, a fast-growing Pythium was obtained from all pieces of stem tissue plated. This isolate grew into a full plate (100mm diameter) on PDA medium within 24 hours at 22 ºC in the dark (Fig G), and produced oogonia, antheridia, and sporangia on corn meal agar (CMA) medium. Based on both morphology and the DNA sequence of the ITS region of rDNA , the isolate was identified as P. aphanidermatum. This disease can be detected using Agdia’s Phytophthora immunoStrip as it cross reacts with Pythium aphanidermatum. Hemp crown and root rot caused by Pythium aphanidermatum was recently reported in Indiana in June, 2017 (https://doi.org/10.1094/PDIS-09-16-1249- PDN). It was found in a small research plot where hemp seeds were planted. The disease described here occurred in a commercial field during the middle of the growth term, affecting a large number of plants. The disease appears to be more aggressive on crown and stem tissue, even though root rot was noticed on some plants. The disease was prevalent when plants were grown under plastic mulch film. Removal of mulch and reduction of soil moisture appeared to reduce the incidence of disease temporarily, but it did not stop the disease development in plants that had been infected
Quantitative vs Qualitative Hop Latent Viroid Testing
www.medicinalgenomics.com/quantitative-vs-qualitative-hlvd-testing/
There are currently no viable treatment options available for Hop Latent Viroid (HLVd) infected cannabis plants. Meristem tissue culture can be used to rescue infected plants, but the process can take up to 3-9 months and doesn’t always result in viroid-free plants. The success rate of tissue culture remediation is often cultivar-specific. Cultivators will surely put in the time and effort to save valuable heirloom cultivars, but many others will scrap infected plants and start a new phenohunt to replace them.
Prevention is surely the best way to protect your operation. There are a number of HLVd testing kits available that cultivators can use to confirm suspected infection or identify asymptomatic plants. Screening mother plants regularly, especially before taking a round of cuttings, would help to ensure only clean plants make it into production. Cultivators should also use extreme caution when introducing new genetics from another facility. New clones should be quarantined and screened for HLVd and other pathogens before they are allowed to share a space with existing plants.
A Case for Using qPCR for HLVd Testing
Medicinal Genomics was the first company to bring Eiken Chemical Co, Ltd.’s patented Loop-Mediated Isothermal Amplification (LAMP)-based testing to the Cannabis field with our youPCR® Gender and THC/CBD testing. We learned a lot from this endeavor and have a few thoughts to share as to why we have not yet deployed this patented technology to Hop Latent Viroid (HLVd) testing out of the gate.
Find Pdf
Quorum quenching is an antivirulence strategy employed by endophytic bacteria
Parijat Kusari & Souvik Kusari & Marc Lamshöft & Selahaddin Sezgin & Michael Spiteller & Oliver Kayser
Appl Microbiol Biotechnol
DOI 10.1007/s00253-014-5807-3
Bacteria predominantly use quorum sensing to regulate a plethora of physiological activities such as cell-cell crosstalk, mutualism, virulence, competence, biofilm formation, and antibiotic resistance. In this study, we investigated how certain potent endophytic bacteria harbored in Cannabis sativa L. plants use quorum quenching as an antivirulence strategy to disrupt the cell-to-cell quorum sensing signals in the biosensor strain, Chromobacterium violaceum. We used a combination of high-performance liquid chromatography high-resolution mass spectrometry (HPLC-ESI-HRMSn ) and matrix-assisted laser desorption ionization imaging highresolution mass spectrometry (MALDI-imaging-HRMS) to first quantify and visualize the spatial distribution of the quorum sensing molecules in the biosensor strain, C. violaceum. We then showed, both quantitatively and visually in high spatial resolution, how selected endophytic bacteria of C. sativa can selectively and differentially quench the quorum sensing molecules of C. violaceum. This study provides fundamental insights into the antivirulence strategies used by endophytes in order to survive in their ecological niches. Such defense mechanisms are evolved in order to thwart the plethora of pathogens invading associated host plants in a manner that prevents the pathogens from developing resistance against the plant/endophyte bioactive secondary metabolites. This work also provides evidence towards utilizing endophytes as tools for biological control of bacterial phytopathogens. In continuation, such insights would even afford new concepts and strategies in the future for combating drug resistant bacteria by quorum-inhibiting clinical therapies.
Not Cannabis Specific
Reducing Botrytis in greenhouse crops: periodic UV-light treatment in tomato plants
Dr. E. Heuvelink
Wageningen, 26 October 2006
Greenhouse growers in The Netherlands, and indeed throughout Europe, face a dilemma in the control of pathogenic fungi on their crops. Their customers demand a product that is free of fungi, while on the other hand, their customers demand a minimal level of pesticide residue (MLR) on the final product, thus severely limiting the options available to the grower in controlling the fungus. In this light, various systems are being developed in Wageningen to assist the growers in controlling fungal growth with minimal or no use of fungicides. One such method is the use of low dosage ultraviolet light. This patented method, owned by Clean Light BV of The Netherlands (PO Box 271, 6700 AG Wageningen, www.cleanlight.nl ), is based on the principle that both fungi and green plants are sensitive to ultraviolet light, but that there is a vast difference in lethal dose between fungi and green plants: Fungi can be killed with a very low dose, while green plants can tolerate much higher doses of ultraviolet light without showing signs of stress. This stands to reason given the observation that green plants survive, and indeed thrive, in full sunlight, while most fungi species only survive in surroundings that are sheltered from direct sunlight. The method then, is based on supplying a dose of ultraviolet light to the fungus that is a) high enough to kill the fungus, while b) low enough, so as not to harm the plant.
Research on crop protection is a very important topic, at the moment
https://www.mmjdaily.com/article/914...at-the-moment/
Crop protection for medical cannabis production in greenhouses or outdoors is a very important topic at the present time. Regulations around the world prohibit the use of chemical crop protections and the search for alternatives to combat diseases and pests is an important one within cannabis operations. Cameron Scott, a graduate student completing a Master’s degree at Simon
Fraser University in Burnaby, B.C. has been focusing on plant diseases that specifically affect the cannabis plant. “If one wants to grow medical cannabis, there are many insect and disease challenges to produce an acceptable crop. That is why research on crop protection is a very important topic at the moment: growers need to be provided with effective solutions that prevent yield loss and protect their crop from being damaged to produce a high quality product for consumers”.
Researchers Identify the Root Pathogens Affecting Hydroponically Grown Cannabis Plants
https://www.analyticalcannabis.com/a...-plants-311240
Dr. Zamir Punja and his research team at the Simon Fraser University in British Columbia have recently published the full results of their three-year-long study into root diseases affecting hydroponically grown cannabis plants.
By sampling plants that exhibited symptoms of root disease - such as stunted growth, brown root lesions, root rot, and leaf discoloration due to minor chlorosis - the research group was able to isolate and identify two genera of pathogens that had infected the plants.
The pathogens from the diseased plants were identified by plating affected root samples on a suitable agar-based medium and letting the fungal cultures develop. These were then broadly identified as being from the Fusarium genus and the Pythium genus and sent to the Agriculture and Food Laboratory in the University of Guelph Laboratory Services for polymerase chain reaction (PCR) analysis, in order to identify the exact species of each fungus that was present. The PCR testing indicated the presence of two species of Pythium (P. dissotocum and P. myriotylum) and two species of Fusarium (F. oxysporum and F. solani). At the tail-end of the study, isolates of Pythium aphanidermatum were also observed in a sub-sample of the diseased root cuttings.
Pythium is a parasitic root fungus which most commonly affects young plants or seedlings. Most Fusarium fungi are actually harmless soil microbes, however, the two species identified here have been known to cause root rot and wilting in plants. Both the Pythium and Fusarium species observed here have been detected in other crops, so it can be concluded that these root pathogens are not uniquely adapted to cannabis.
Root and crown rot pathogens causing wilt symptoms on field-grown marijuana (Cannabis sativa L.) plants
Zamir K. Punja, Cameron Scott & Sarah Chen
Canadian Journal of Plant Pathology Volume 40, 2018 - Issue 4
DOI: 10.1080/07060661.2018.1535470
Yellowing and wilting symptoms on field-grown Cannabis sativa (cannabis) plants followed by total plant collapse under conditions of extreme hot weather were observed in northern California in 2017. The crown regions of affected plants were dark and sunken and internal tissue discolouration extended 10–15 cm above the soil surface. Isolations made from the pith, vascular and cortical tissues in the crown region yielded Fusarium oxysporum (40% frequency), F. brachygibbosum (28% frequency), Pythium aphanidermatum (22% frequency),Fusarium solani and F. equiseti (5% frequency each). Pathogenicity tests were conducted on rooted plantlets to establish the extent of root and crown decay, as well as on mature stems to determine the extent of stem tissue colonization caused by these species. Extensive reduction in root length was caused by F. solani, F. oxysporum, F. brachygibbosum and P. aphanidermatum and wounding significantly enhanced disease development. Stem tissue colonization by these pathogens at wound sites was similarly extensive. Isolates of F. equisetiwere non-pathogenic. Both F. solani and P. aphanidermatum caused plant mortality within 6–10 weeks following inoculation. In phylogenetic analyses using the internal transcribed spacer (ITS) rDNA region and the elongation factor 1 (EF-1?) region, F. oxysporum isolates from cannabis plants in northern California were grouped separately from all other formae speciales and from isolates previously recovered from British Columbia. Two isolates of F. brachygibbosum were identical to an isolate previously reported to infect almond stems in cold storage and field-grown seedlings in northern California. These findings indicate that a complex of pathogens potentially can cause root and crown rot under field conditions, resulting in wilt symptoms and collapse of cannabis plants.
Sequence resource of bacterial communities associated to hemp in Ohio.
Willman, M., Keener, H. M., & Benitez Ponce, M.-S.
Phytobiomes Journal.(2020).
doi:10.1094/pbiomes-09-20-0062-a
In spite of changes in regulation, and increased hemp cultivation and commercialization, information on hemp best production practices in the US is scarce. Due to hemp’s human consumption, particularly as concentrated oil, hemp is often grown with low synthetic chemical
inputs. Therefore, microbiome management and the use of microbial inoculants are important tools to increase hemp productivity. As a first step to characterize the hemp core microbiome, we completed a survey of bacterial communities, associated with different tissue types of plants
grown in a field in Ohio. This local dataset could be integrated with further hemp microbiome surveys to identify potential beneficial interactions relevant to plant health and productivity, but also to evaluate microbiome impacts on product efficacy and safety.
Not Cannabis Specific
Silencing of CrNPR1 and CrNPR3 Alters Plant Susceptibility to Periwinkle Leaf Yellowing Phytoplasma.
Sung, Y.-C., Lin, C.-P., Hsu, H.-J., Chen, Y.-L., & Chen, J.-C.
Frontiers in Plant Science, 10. (2019).
doi:10.3389/fpls.2019.01183
Phytoplasmas are prokaryotic plant pathogens that cause considerable loss in many economically important crops, and an increasing number of phytoplasma diseases are being reported on new hosts. Knowledge of plant defense mechanisms against such pathogens should help to improve strategies for controlling these diseases. Salicylic acid (SA)-mediated defense may play an important role in defense against phytoplasmas. Here, we report that SA accumulated in Madagascar periwinkle (Catharanthus roseus) infected with periwinkle leaf yellowing (PLY) phytoplasma. CrPR1a expression was induced in both symptomatic and non-symptomatic tissues of plants exhibiting PLY. NPR1 plays a central role in SA signaling, and two NPR1 homologs, CrNPR1 and CrNPR3, were identified from a periwinkle transcriptome database. Similar to CrPR1a, CrNPR1 expression was also induced in both symptomatic and non-symptomatic tissues of plants exhibiting PLY. Silencing of CrNPR1, but not CrNPR3, significantly repressed CrPR1a induction in Tobacco rattle virus-infected periwinkle plants. In addition, symptoms of PLY progressed fastest in CrNPR1-silenced plants and slowest in CrNPR3-silenced plants. Consistently, expression of CrNPR1, but not CrNPR3, was induced by phytoplasma infection as well as SA treatment. This study highlights the importance of NPR1- and SA-mediated defense against phytoplasma in periwinkle and offers insight into plant-phytoplasma interactions to improve disease control strategies.
Southern Blight of Hemp caused by Athelia rolfsii detected in Virginia.
Mersha, Z., Kering, M., & Ren, S.
Plant Disease. (2019).
doi:10.1094/pdis-10-19-2178-pdn
Hemp (Cannabis sativa L.) is an annual herb from Cannabaceae family grown for its multitude of uses including fiber, seed and/or oil, and for its medicinal benefits. In August 2019, a hemp farm was visited in Dinwiddie County, Virginia. At one of the locations where the CBD variety ‘Boax’ plants were grown in drip irrigated and plastic mulch covered raised beds, three suspect plants with intermittent but conspicuous yellowing of foliage were clearly discernible. Disease incidence during the time of the visit, including the few symptomatic plants which were already removed after succumbing to the disease, was estimated between 0.5 to 2.0%. Brown to dark lesions, covered for most part by a white fluffy and, at times, by a fan-shaped mycelium that extended from the lower stem to the crown area near the soil-line were visible upon opening up the canopy. The lesions were irregular shaped and extended along the stem perimeter with lesion length ranging between 5 to 62 mm (mean = 24.4 mm). Brownish mustard-seed-like sclerotia of 0.4 to 1.6 mm in diameter (mean = 0.8, n = 34) were seen on the white fluffy mycelium at the soil-line. A sclerotium was aseptically placed at the center of acidified potato dextrose agar (APDA) and incubated at 30°C in the dark. Within 96 h, the white mycelia of the fungus was observed to have clamp connections and completely covered the 85 mm diamter Petri dishes. Slightly bigger sized sclerotia of 1.2 to 4.2 mm in diameter (mean = 2.2, n = 30) were formed 7 days later.
Storage of cannabinoids by Arctia caja and Zonocerus elegans fed on chemically distinct strains of Cannabis sativa.
ROTHSCHILD, M., ROWAN, M. G., & FAIRBAIRN, J. W.
Nature, 266(5603), 650–651. (1977).
doi:10.1038/266650a0
The larva of the warningly coloured tiger moth Arctia caja (L.) (Lepidoptera) and the grasshopper Zonocerus elegans (Thunberg) (Acridoidea) are polyphagous feeders with a predilection for poisonous foods plants. These species can sequester a store various secondary plant substances such as cardiac glycosides and pyrrolizidine alkaloids which presumably function as predator deterrents. We report here that cannabinoids are also stored by both insects. There is good evidence that Cannabis sativa contains at least two chemical races or strains, one rich in the psychoactive substance delta-1-Tetrahydrocannabinol (THC) and the other in the inactive cannabidiol (CBD) and accordingly one of each type was used in our work.
Striatura Ulcerosa
John McPartland, Karl Hillig
June 2004Journal of Industrial Hemp 9(1):89-96
DOI: 10.1300/J237v09n01_10
This is the second in a series of “Cannabis clinic” notes, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. This note concerns Striatura Ulcerosa, the name of a hemp disease caused by the bacterium Pseudomonas syringae pv. mori. The disease was first described in Italy over 100 years ago, but may have originated in China. Greenhouse studies demonstrated that all cultivars of Cannabis are susceptible. Signs and symptoms, life history of the pathogen, and control measures are discussed.
Surveying for Potential Diseases and Abiotic Disorders of Industrial Hemp (Cannabis sativa) Production
Lindsey D. Thiessen, Tyler Schappe, Sarah Cochran, Kristin Hicks, and Angela R. Post
Plant Health Progress 14 Oct 2020
DOI: 10.1094/PHP-03-20-0017-RS
ndustrial hemp (Cannabis sativa L.) has recently been reintroduced as an agricultural commodity in the United States, and, through state-led pilot programs, growers and researchers have been investigating production strategies. Diseases and disorders of industrial hemp in the United States are largely unknowns because record-keeping and taxonomy have improved dramatically in the last several decades. In 2016, North Carolina launched a pilot program to investigate industrial hemp, and diseases and abiotic disorders were surveyed in 2017 and 2018. Producers, consultants, and agricultural extension agents submitted samples to the North Carolina Department of Agriculture and Consumer Services Agronomic Services Division (n = 572) and the North Carolina Plant Disease and Insect Clinic (n = 117). Common field diseases found included Fusarium foliar and flower blights (Fusarium graminearum), Fusarium wilt (Fusarium oxysporum), and Helminthosporium leaf spot (Exserohilum rostratum). Greenhouse diseases were primarily caused by Pythium spp. and Botrytis cinerea. Common environmental disorders were attributed to excessive rainfall flooding roots and poor root development of transplanted clones.
The diverse mycoflora present on dried cannabis (Cannabis sativa L., marijuana) inflorescences in commercial production.
Punja, Z. K.
Canadian Journal of Plant Pathology, 1–13.(2020).
doi:10.1080/07060661.2020.1758959
The objective of this study was to assess harvested dried inflorescences (buds) of cannabis (Cannabis sativa L., marijuana) for fungal presence and diversity. Samples from drying rooms of three licenced facilities in British Columbia were tested repeatedly during 2017–2019. A swab method was used, wherein sterile cotton swabs were gently swabbed over bud surfaces and directly streaked onto potato dextrose agar containing 140 mg L?1 streptomycin sulphate. Petri dishes were incubated at 21–24°C for 5–6 days and the fungal colonies that developed were recorded. The testing was repeated to provide >40 cumulative sampling times over a 2-year period. Representative colonies of each unique morphological type were identified to genus and species by PCR of the ITS1-5.8-ITS2 region of rDNA and sequence analysis. Among 34 different fungal species identified, the most prevalent were Penicillium (comprising 17 different species), followed by species of Cladosporium, Botrytis, Aspergillus, Fusarium, Talaromyces and Alternaria. All samples had several fungal species present and the number and composition varied at different sampling times and within different facilities. The swab method provided a qualitative assessment of viable mould contaminants on cannabis buds and reflected the diversity of mycoflora present, many of which are previously unreported. Fungi on cannabis buds may originate from spores released from diseased or decomposing plant materials, from growing substrates used in cannabis production, or as airborne contaminants in post-harvest trimming and drying rooms. Samples of dried buds exposed to electrobeam (e-beam) radiation treatment had no detectable fungal contamination when assessed using the swab method.
Not Cannabis specific
The Effect of Blue-light-emitting Diodes on Antioxidant Properties and Resistance to Botrytis cinerea in Tomato
Kangmin Kim, Hee-Sun Kook, Ye-Jin Jang, Wang-Hyu Lee, Seralathan Kamala-Kannan, Jong-Chan Chae and Kui-Jae Lee
J Plant Pathol Microb 4: 203.
doi:10.4172/2157- 7471.1000203
In higher plants, blue-light is mainly perceived by cryptochromes and phototropins, which subsequently orchestrates phototropism, chloroplast relocation, stomatal opening, rapid inhibition of hypocotyl elongation and leaf expansion. Blue-light signaling is also known to mediate the plant responses to biotic stresses, but relevant mechanisms are largely unknown. Here, we demonstrated that blue LED (Light Emitting Diode)-driven inhibition of gray mold disease was highly correlated with the increases in cellular protectants like proline, antioxidants and ROS (Reactive Oxygen Species) scavenger activities. After twenty one days of exposure to various wavelengths of LED lights, blue-LED treated tomato displayed significant increases in proline accumulation in the leaves and stems, whereas red- and green-LED treated tomato exhibited the lower proline contents. Similarly, the blue-LED treatment increased the amount of polyphenolic compounds in tomatoes, compared to other wavelength of LED lights. The activities of various ROS (Reactive Oxygen Species) scavenging enzymes were also slightly increased under the blue-LED lighted conditions. Finally, blue-LED significantly suppressed symptom development of tomato infected by gray mold. Combined results suggest that blue LED light inhibits the development of gray mold disease, which can be mechanistically explained by the enhanced proline accumulation and antioxidative processes at least in partial.
NOT CANNABIS SPECIFIC but this virus is found in Cannabis
The elimination of viruses and Hop Latent Viroid from hop (Humulus lupulus L.) in Poland
M. Grudziska, E. Solarska
February 2005Acta horticulturae 668(668):149-152
DOI: 10.17660/ActaHortic.2005.668.19
Hops in Poland are commonly infected with Hop latent viroid (HLVd) and viruses: Prunus necrotic ringspot virus (PNRSV) and Hop mosaic virus (HpMV). Previous experiments were successful in obtaining virus-free hop plants by heat therapy method but appeared to be inefficient for HLVd elimination. In these studies virus and viroid free hop plants were obtained by meristem-tip culture. The meristem tips were excised from lateral shoot tips of naturally infected plants and placed in vitro. In vitro regeneration ability varied between 0 and 46% of regenerated explants depending upon cultivar, depending upon the time at which meristems tips were obtained. The regenerated plants were tested by ELISA for the presence of viruses and by RT-PCR for the presence of HLVd. Plants with no detectable viruses and HLVd were used for further propagation.
Not Cannabis Specific, but found in Cannabis
The experimental transmission of hop latent viroid and its elimination by low temperature treatment and meristem culture
A N ADAMS, D J BARBARA, A MORTON and P DARBYAnnals of Applied Biology 128(1):37 - 44
DOI: 10.1111/j.1744-7348.1996.tb07087.x
Two aspects of hop latent viroid (HLVd) relevant to control were examined:
the production of viroid-free plants from infected material and transmission of HLVd in the field. Plants free from HLVd were obtained by a combination of storing infected source plants at low temperature (2-4°C in the dark) for several months followed by meristem culture using small explants. A total of 77 plants of six cultivars and male pollinator clones were grown from meristems and 28 of these were free from HLVd. Tests showed that the cutting of stems (mimicking the use of tools) was more effective than abrasion (mimicking natural plant to plant contact) for the mechanical transmission of HLVd between hop plants. When field-grown test plants were inoculated, infection occurred more commonly in May before plants had grown large enough for significant contact between neighbouring plants than later in the season. The aphid Phorodon humuli could not be shown to transmit HLVd.
These results indicate that all hop varieties and pollinator clones can be made available to the industry free from HLVd and that the chances of infection can be reduced by avoiding early-season cultural operations that cut into hop shoots.
The Hemp Russet Mite
John McPartland, Karl Hillig
March 2003 Journal of Industrial Hemp 8(2):107-112
DOI: 10.1300/J237v08n02_10
The hemp russet mite Aculops cannabicola (Farkas) is a little-known but potentially dreadful pest. It primarily feeds on leaves, petioles, and meristems. The mites quickly spread between plants grown in proximity. They cause a curling of leaf edges, followed by leaf russeting. The mites feed on the inflorescences of both sexes, and on glandular trichomes, severely reducing resin production. The hemp russet mite constitutes a real menace to world hemp cultivation, because it cannot be controlled easily.
The hemp russet mite Aculops cannabicola (FARKAS, 1960) (ACARI: ERIOPHYOIDEA) FOUND ON CANNABIS SATIVA L. IN SERBIA: SUPPLEMENT TO THE DESCRIPTION
RADMILA PETANOVI, BILJANA MAGUD, and DRAGICA SMILJANI?
Arch. Biol. Sci., Belgrade, 59 (1), 81-85, 2007.
DOI: 10.2298/ABS0701081P
The description of Aculops cannabicola (Farkas, 1960), a new species for the fauna of Serbia, is supplemented. The male and juveniles are described for the first time. This species was found as vagrants on leaves of hemp, Cannabis sativa L. A comparison of characters of the population from Serbia and the originally described samples from Hungary is given.
The Impact of Insect Herbivory in the Level of Cannabinoids in CBD Hemp Varieties
Brandon Jackson, Lenneisha Gilbert, Tigist Tolosa, Shellyann Henry, Victoria Volkis, Simon Zebelo
DOI: 10.21203/rs.3.rs-155271/v1
https://www.researchgate.net/publica...Hemp_Varieties
Background
In the United States, industrial hemp is dened as a Cannabis sativa L. plant not containing more than 0.3% delta-9-tetrahydrocannabinol (D9THC) by dry weight. Plants respond to insect herbivore damage by
changing their chemistry to counter the effects of herbivore attack. Here, we hypothesized that the corn earworm (Helicoverpa zea) infestation might impact the level of cannabinoids (Cannabidiol (CBD) and D9THC).
Results
In a laboratory trial, the CBD hemp, Cherry Blossom, and The Wife varieties were subjected to herbivore damage (HD), Mechanical damage (MD), and Control. After 24hrs of the treatments, we found a significant increase in CBD and D9THC in HD plants compared with MD and Control plants. Similar experiments were conducted in the field condition. A substantial increase in CBD and D9THC observed in herbivore damaged hemp plants compared to the control plants. However, in the field trial, the levels of cannabinoids were not significantly higher in The wife variety. Interestingly, the Corn earworm larvae fed with CBD and D9THC spiked diet showed a significant reduction in body mass, as compared to the larvae fed with the control diets.
Conclusions
The level of cannabinoids seems not genetically xed somewhat; it is affected by insect herbivory. Our results suggest that CBD hemp plants are exposed to insect herbivory spikes in cannabinoid production and surpass the 0.3 % legal limit of D9THC. The growth and development of Corn earworm, the number one hemp pest in North America affected by cannabinoids. The increased concentration of CBD and D9THC observed in herbivore damaged hemp plants might be associated with the direct deterrence of the corn earworm larvae. Further research underway using different hemp varieties to assess if herbivory and other biotic stressors impact the level of cannabinoids.
NOT CANNABIS SPECIFIC but this virus us found in Cannabis
The molecular structure of hop latent viroid (HLV), a new viroid occurring worldwide in hops.
Puchta H1, Ramm K, Sänger HL.
Nucleic Acids Res. 1988 May 25;16(10):4197-216.
DOI: 10.1093/nar/16.10.4197
A new viroid which does not seem to produce any symptoms of disease, and is therefore tentatively named hop latent viroid (HLV) was found to occur worldwide in hops. HLV proved to be infectious when mechanically inoculated onto viroid- and virus-free hops. The viroid nature of HLV was also substantiated by sequence analysis which revealed that HLV is a circular RNA consisting of 256 nucleotides, that can be arranged into the viroid-specific, rod-like secondary structure. HLV also contains the central conserved region typical for most of the presently known viroids. However HLV does not contain the viroid-specific oligo(A) stretch in the upper left part of its rod-like molecule. Because of this feature and a sequence similarity with the prototypes of the other viroid groups below 55%, HLV can be regarded as the first member of a new viroid group.
The occurrence of Hop latent viroid causing disease in Cannabis sativa in California.
Jeremy Warren, Jennifer Mercado, Dan Grace (Dark Heart Nusery report)
Plant Disease
doi.org/10.1094/PDIS-03-19-0530-PDN
https://www.researchgate.net/publica...ldwide_in_hops
In 2017 disease symptoms were noticed on multiple cultivars of Cannabis sativa plants grown in California, including; stunting, malformation or chlorosis of leaves, brittle stems and reduction in yields. Additionally, cuttings taken from symptomatic plants for clonal propagation showed a reduced rooting success rate. Leaf tissues from five symptomatic and five asymptomatic plants were selected for RNA isolation and subsequent sequencing from northern California (37.7567466, -122.1930517). Total RNA was isolated from leaf tissue using TRIzol reagent (Thermo Fisher). Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit, Plant (Illumina). RNA-seq libraries were synthesized using YourSeq RNA-seq kit for full transcript coverage libraries (Amaryllis Nucleics, Oakland California). Libraries were sequenced on an Illumina NextSeq 500 using single-read 80bp (Amaryllis Nucleics). Each sample resulted in between 12,861,714 and 19,376,549 reads (data available at www.mg-rast.org project HpLVd – Can). The resulting sequences were de novo assembled and the resulting contigs were aligned to the Cannabis sativa draft genome (ASM341772v2). Contigs that matched the Cannabis sativa genome were removed from the analysis and the remaining contigs were compared to sequences in the viral and viroid Genbank databases. All five symptomatic plants had a single 256 nucleotide contig (total reads mapped per contig: ranged from 4,162 to 50,095) that matched Hop latent viroid (HLVd).
The Occurrence of Hop Latent Viroid in Cannabis sativa with symptoms of Cannabis Stunting Disease in California
Ali Bektas, Kayla M. Hardwick, Kristen Waterman, Jessica Kristof
June 2019 Plant Disease
DOI: 10.1094/PDIS-03-19-0459-PDN
In February 2018 we sampled three symptomatic and three asymptomatic Cannabis plants suspected to host a viral agent from a farm in Santa Barbara County, CA. The symptoms included brittle stems, an outwardly horizontal plant structure and reduced flower mass and trichomes. RNA from each flower sample was extracted using a QIAmp Viral Mini Kit (Qiagen, Hilden, Germany). RNA was purified, concentrated, and ribo-depleted before library construction with NEBNext Ultra II Directional RNA kit (NEB, Ipswich, MA). Individual libraries were tagged with unique adapters and pooled for sequencing with a NextSeq High Output 300 cycle kit (Illumina, San Diego, CA). Sequence data were assembled with Trinity (Grabherr et al. 2011), and Blobtools (Laetsch and Blaxter 2017) was used to search for viral sequences. Possible viral transcripts were filtered for at least 10× coverage, 95% BLAST identity, and alignment length greater than 80% of query and subject sequences. One hundred twenty-five transcripts showed significant similarity to hop latent viroid (HLVd) sequence EF613183. We used STAR (Dobin et al. 2013) to align reads to the transcripts and found that 2.4% of read pairs from symptomatic libraries (of a total of 153,001,495 read pairs) and 0.0001% of read pairs from asymptomatic libraries (of a total of 159,608,791 read pairs) mapped to the putative HLVd sequences. We also identified a transcript with high homology to C. sativa mitovirus 1 (BK010428). Reads from all libraries mapped to this transcript in similar numbers; thus, the mitovirus is unlikely to be associated with the disease symptoms. To confirm our findings, we used two HLVd-specific primer pairs in reverse transcription PCR (RT-PCR). The Zeigler et al. (2014) primer pair produced the expected HLVd amplicon size from only the symptomatic plants, whereas the primer pair of Eastwell and Nelson (2007) produced the expected HLVd amplification pattern from all samples collected. The amplicons were Sanger sequenced and produced at least 200 bp of data with 95% or more pairwise identity to HLVd sequences in GenBank. One sample, CV1 (MK791751), produced 98% pairwise identity across the whole 256-bp HLVd genome as published by Puchta et al. (AX07397). In February 2019, we sampled seven symptomatic and three asymptomatic plants from another farm in Alameda County, CA. RT-PCR revealed the presence of HLVd in all symptomatic plants and one asymptomatic plant. Amplicons from four of these samples were Sanger sequenced and confirmed to be HLVd (MK791747 to MK791750). Analysis of the sequences obtained from the two locations revealed two single-nucleotide polymorphisms between them at positions 190 and 225, which include the centrally conserved region (Puchta et al. 1988). The consistent detection of HLVd alone in all symptomatic plants from both locations and its occurrence in only a few asymptomatic plants point to an association of the disease with the stunted Cannabis. HLVd can persist in hops without symptoms, and Cannabis cultivators should take measures to minimize mechanical transmission while keeping in mind that HLVd may also be seed transmissible (Pethybridge et al. 2008). Considering the detrimental effects of HLVd to the commercially valuable secondary metabolites of the species, a thorough investigation of susceptibility as well as range and expression of Cannabis stunting disease should be conducted at this important juncture.
NOT CANNABIS SPECIFIC
The specific host plant DNA detection suggests a potential migration of Apolygus lucorum from cotton to mungbean fields
Qian Wang1, Wei-Fang Bao, Fan Yang, Bin Xu1, Yi-Zhong Yang
PLoS ONE 12(6): e0177789.
Doi: 10.1371/journal.pone.0177789
The polyphagous mirid bug Apolygus lucorum (Heteroptera: Miridae) has more than 200 species of host plants and is an insect pest of important agricultural crops, including cotton (Gossypium hirsutum) and mungbean (Vigna radiata). Previous field trials have shown that A. lucorum adults prefer mungbean to cotton plants, indicating the considerable potential of mungbean as a trap crop in cotton fields. However, direct evidence supporting the migration of A. lucorum adults from cotton to mungbean is lacking. We developed a DNA-based polymerase chain reaction (PCR) approach to reveal the movement of A. lucorum between neighboring mungbean and cotton fields. Two pairs of PCR primers specific to cotton or mungbean were designed to target the trnL-trnF region of chloroplast DNA. Significant differences in the detectability half-life (DS50) were observed between these two host plants, and the mean for cotton (8.26 h) was approximately two times longer than that of mungbean (4.38 h), requiring weighted mean calculations to compare the detectability of plant DNA in the guts of field-collected bugs. In field trials, cotton DNA was detected in the guts of the adult A. lucorum individuals collected in mungbean plots, and the cotton DNA detection rate decreased successively from 5 to 15 m away from the mungbean-cotton midline. In addition to the specific detection of cotton- and mungbean-fed bugs, both cotton and mungbean DNA were simultaneously detected within the guts of single individuals caught from mungbean fields. This study successfully established a tool for molecular gut-content analyses and clearly demonstrated the movement of A. lucorum adults from cotton to neighboring mungbean fields, providing new insights into understanding the feeding characteristics and landscape-level ecology of A. lucorum under natural conditions.
The Threat of Viral Cannabis Diseases
Robert Clarke
Cannabis Business Times Aug. 2020 pg 44-48
https://www.cannabisbusinesstimes.c...ns-the-threat-of-viral-cannabis-diseases-cds/
Around the world people are coming to grips with the health issues and economic fallout of COVID-19. Public awareness of viral contagions is reaching unprecedented levels, presenting an opportune moment to address disease problems within the cannabis industry. As we are seeing with health issues and economic fallout of COVID-19. Public awareness of viral contagions is reaching unprecedented levels, presenting an opportune moment to address disease problems within the cannabis industry. As we are seeing with the novel coronavirus pandemic, harmful viruses emerge and adapt, and this is not exclusive to humans. Cannabisgrowers are increasingly experiencing the negative economic outcomes of decreased vigor, lower flower yields and reduced production of primary target compounds including both cannabinoids and terpenoids. What we are calling “Cannabisdisease syndrome” exhibits a suite of consistent symptoms, but with no readily apparent single cause. These symptoms, which do not appear to be caused by nutrient deficiencies or other pathogens, are often collectively referred to as “dudding” or “dudders.” (The term originated when growers would think a plant with decreased vigor or stunted growth was “just a dud.”)
Steadily declining vigor in commercial Cannabisclones is not a new phenomenon. As vegetative reproduction by rooting cuttings became popular in the 1980s, growers would occasionally see a clone that became weaker and less productive each time cuttings were flowered. Apart from lowered yield, there were few other symptoms of infection. We tentatively called this a “photocopy effect” based on our analogy that copying a copy of a copy of a copy, results in a faded image that eventually becomes a mere ghost of the original. We knew that because lost vigor was appearing in asexuallymultiplied serial cuttings the problem could not be explained by “genetic drift,” which is a shift in the frequency of genes within a small sexuallyreproducing population. Growers wondered what the causes might be, and even addressed the possibility that simply making serial cuttings might result in diminished vigor. Soon we realized the symptoms were caused by transmission of an infectious disease that became more and more prevalent through successive rounds of multiplication. (More on this later.) We destroyed clones exhibiting symptoms, carefully sterilized benches, pots and tools, and began to use fresh blades when taking cuttings from each mother plant. There were no known causes, just obvious adverse effects. Yet we found practical solutions, and soon the problem nearly disappeared. Some similarities exist between the Cannabis disease syndrome (CDS) we are experiencing today and COVID-19. Much like the human coronavirus, CDS is difficult to detect at first, as there. is a wide range of symptoms. Through our and other growers’ observations of affected plants during the past few years, we have learned that vegetative plants can transmit CDS, while flowering plants are more likely to suffer the consequences. Because symptoms are not readily visible and are easily confused with other diseases, they both lie hidden within populations, and can very quickly become economically impactful. Another similarity between CDS and COVID-19 is that asymptomatic plants can infect the otherwise healthy, with more serious outcomes for some than others. Molecular testing is required to identify potential infections, and there are few laboratories that can effectively identify the causal organisms. Other than practicing social distancing and establishing quarantines, there are as yet no solutions to stopping their spread. Cannabis disease syndrome cannot be attributed to a single pathogen, although there is a primary candidate for its cause (more on this later). In symptomatic plants, several infectious organisms may be involved, making accurate diagnosis and effective control even more difficult. If CDS killed more of its hosts rather than simply making them sick, then it would have been noticed much earlier, and should not have already spread so widely. As we also have observed while studying affected plants, the cannabis disease syndrome spreads most quickly by taking cuttings from infected plants, using them as mother plants, and thereby multiplying the disease through future generations.
The Use of Cannabis sativa L. for Pest Control: From the Ethnobotanical Knowledge to a Systematic Review of Experimental Studies
Genı´s Ona, Manica Balant, Jose´ Carlos Bouso, Airy Gras, Joan Valle`s, Daniel Vitales, and Teresa Garnatje
Cannabis and Cannabinoid Research Volume X, Number X, 2021
DOI: 10.1089/can.2021.0095
https://www.liebertpub.com/doi/abs/1...ournalCode=can
Background: Despite the benefits that synthetic pesticides have provided in terms of pest and disease control, they cause serious long-term consequences for both the environment and living organisms. Interest in ecofriendly products has subsequently increased in recent years.
Methods: This article briefly analyzes the available ethnobotanical evidence regarding the use of Cannabis sativa as a pesticide and offers a systematic review of experimental studies.
Results: Our findings indicate that both ethnobotanical and experimental procedures support the use of C. sativa as a pesticide, as remarkable toxicity has been observed against pest organisms. The results included in the systematic review of experimental studies (n = 30) show a high degree of heterogeneity, but certain conclusions can be extracted to guide further research. For instance, promising pesticide properties were reported for most of the groups of species tested, especially Arachnida and Insecta; the efficacy of C. sativa as a pesticide can be derived from a wide variety of compounds that it contains and possible synergistic effects; it is crucial to standardize the phytochemical profile of C. sativa plants used as well as to obtain easily reproducible results; appropriate extraction methods should be explored; and upper inflorescences of the plant may be preferred for the production of the essential oil, but further studies should explore better other parts of the plant.
Conclusion: In the coming years, as new findings are produced, the promising potential of C. sativa as a pesticide will be elucidated, and reviews such as the present one constitute useful basic tools to make these processes easier.
Find Pdf
(Not Cannabis specific but virus is found in Cannabis)
The Variability of Hop Latent Viroid as Induced upon Heat Treatment.
Matoušek, J., Patzak, J., Orctová, L., Schubert, J., Vrba, L., Steger, G., & Riesner, D.
Virology, 287(2), 349–358. (2001).
doi:10.1006/viro.2001.1044
We have previously shown that heat treatment of hop plants infected by hop latent viroid (HLVd) reduces viroid levels. Here we investigate whether such heat treatment leads to the accumulation of sequence variability in HLVd. We observed a negligible level of mutated variants in HLVd under standard cultivation conditions. In contrast, the heat treatment of hop led to HLVd degradation and, simultaneously, to a significant increase in sequence variations, as judged from temperature gradient–gel electrophoresis analysis and cDNA library screening by DNA heteroduplex analysis. Thirty-one cDNA clones (9.8%) were identified as deviating forms. Sequencing showed mostly the presence of quadruple and triple mutants, suggesting an accumulation of mutations in HLVd during successive replication cycles. Sixty-nine percent of base changes were localised in the left half and 31% in the right half of the secondary structure proposed for this viroid. No mutations were found in the central part of the upper conserved region. A “hot spot” region was identified in a domain known as a “pathogenicity domain” in the group representative, potato spindle tuber viroid. Most mutations are predicted to destabilise HLVd secondary structure. All mutated cDNAs, however, were infectious and evolved into complex progeny populations containing molecular variants maintained at low levels.
Three Botrytis species found causing gray mold on industrial hemp (Cannabis sativa) in Oregon
A.R. Garfinkel
DOI: 10.1094/PDIS-01-20-0055-PDN
In September and October of 2019, flowers of hemp plants in Polk and Linn counties in Oregon showed symptoms of die-back with necrosis of the tissues, resulting in significant yield reductions. The tops of the inflorescences were often the most severely affected with the infection sometimes moving down into the petiole or stem. Up to 90% of the plants in these fields had at least one flower infection present, however, foliar symptoms (lesions) were not observed. Gray to white mycelium and Botrytis-like conidiophores could often be seen arising from host tissue. The fungus was recovered from colonized plant tissues either by placing conidia directly onto a Petri dish containing potato dextrose agar (PDA) or placing a small piece of surface sterilized plant tissue onto PDA. A total of 23 pure cultures were recovered from three fields. All cultures displayed white to gray, fast-growing mycelium within which conidiophores sometimes developed bearing Botryose clusters of conidia, followed by the formation of black sclerotia in all isolates.
Too Many Mouldy Joints – Marijuana aand Chronic Pulmonary Aspergillosis
Yousef Gargani, Paul Bishop and David W. Denning
Mediterr J Hematol Infect Dis 2011, 3; Open Journal System
DOI 10.4084/MJHID.2011.005
Chronic pulmonary aspergillosis is a progressive debilitating disease with multiple underlying pulmonary diseases described. Here we report the association of chronic pulmonary aspergillosis and long term marijuana smoking in 2 patients and review the literature related to invasive and allergic aspergillosis.
Toxic effects of palpoluck Polygonum hydropepper L. and Bhang Cannabis sativa L. plants extracts against termites Heterotermes indicola (Wasmann) and
Coptotermes heimi (Wasmann) (Isoptera: Rhinotermitidae)
Hayat Badshah, Abdus Sattar Khan, Abid Farid, Alam Zeb
and Amanullah Khan
Songklanakarin J. Sci. Technol., 2005, 27(4) : 705-710
https://thaiscience.info/Journals/Ar...G/10986937.pdf
A research project was carried out aimed at to study the toxic effects of Palpoluck Polygonum hydropipper L. and Bhang Cannabis sativa L. crude extracts against two species of termites i.e. Heterotermes indicola (Wasmann) and Coptotermes heimi (Wasmann) at Nuclear institute for Food and Agriculture (NIFA) Peshawar, Pakistan in April 2002. Results revealed that after ten days of feeding maximum percent mortality in case of Polygonum hydropipper L. leaf and flower extracts was 28.0, 52.0, 28 and 74.7 for H. indicola and Coptotermes heimi respectively, while in control only 10.7 and 12.0% mortality were recorded. Similarly, for the same species of termites the percent mortality in Cannabis sativa L. extracts was 54.7, 64.0, 58.7 and 70.7 for leaf and seed extracts respectively, while in control only 12.0 and 10.7% mortality were observed. In each extract mortality was significantly different from that of control. Toxic effects of both extracts (leaf and flower) were more profound against Coptotermes heimi than Heterotermes indicola during these ten days of feeding. Also the seed extracts caused more mortality than the leaves for both species, suggesting the availability of high contents of toxic materials in seed.
Two Aphid Species, Phorodon cannabis and Rhopalosiphum
rufiabdominal, Identified as Potential Pests on Industrial Hemp, L., in the US Midwest
Doris Lagos-Kutz, Bruce Potter, Christina DiFonzo,Glen L. Hartman, Russell A. Howard
January 2018 Project: Suction Trap Network in the Midwest
DOI: 10.2134/cftm2018.04.0032
Cannabis sativa L. is indigenous to eastern Asia, grown since ancient times for its medicinal and textile uses (Russo et al., 2008). In the USA, production is currently increasing (USDA-NRCS, 2018)
for industrial fiber, seed oil, medicinal and recreational uses. As production increases, there is growing interest in properly identifying and managing pests attacking the crop in both field and greenhouse environments. In this brief we provide new records of distribution of Phorodon cannabis, a recently introduced insect species in the USA, and Rhopalosiphum rufiabdominale, a widely distributed species on grasses and other dicots. In addition, we are including morphological and molecular information of P. cannabis and P. humuli to avoidthe misidentification of these two closely related insect species
Using Ultraviolet Light to Stop Gray Mold, Powdery Mildew & Other Marijuana Plagues
Marijuana Growing Educators April 9, 2019
https://growingmarijuanaperfectly.co.. .ana-grow-room/
This is an important update to an article we posted a while ago, about using ultraviolet light to fight gray mold, powdery mildew and similar marijuana enemies. The photo you see just above this text shows you two marijuana leaves–one treated with ultraviolet light, and the other not treated. The untreated leaf is infested with powdery mildew, but an ultraviolet light device made by a company called CleanLight blocked powdery mildew on the other leaf!
Ultraviolet light can kill molds and fungi, which are some of the biggest causes of crop failures in marijuana grow rooms. Obviously, you want to know how to do that same mildew-killing ultraviolet treatment in your marijuana garden. In the original version of this article, we discussed an ultraviolet device called the Reme Halo. The Halo is a tiny device that has to be installed by an HVAC professional inline in your grow op building’s air handler. It uses a low-watt ultraviolet light and an ionized hydroperoxide generator to scrub air. The manufacturer claims it removes mold, fungi, and odor.
Not Cannabis Specific
UV light offers possibilities against powdery mildew
https://cleanlight.nl/wp-content/upl...ery-mildew.pdf
The latest experiments with UV light indicate that fewer fungicide applications are required when applied in the correct manner. DLV (research group) tested the potential of UV light treatments on several nursery crops and perennials.
Western Plant Diagnostic Network News : Pythium aphanidermatum Crown Rot of Industrial Hemp
September 2017
Jennifer Schoener, Shouhua Wang, Rus Wilhelm
https://www.npdn.org/system/files/NPDN_September-17.pdf
Cultivation of industrial hemp (Cannabis sativa) was first approved in 2014 for the purpose of research and development. The Federal Farm Bill Section 7606 authorizes state agencies to conduct pilot trials on the crop to assess crop viability for the creation of an industry in prospective states. In Nevada, the Department of Agriculture authorizes the production of hemp crops for research purposes. The acreage of hemp production in Nevada is relatively small in comparison to the acreage in other states. However, plant diseases associated with hemp crops have been occurring in Nevada in recent years. In 2016, the Nevada Department of Agriculture Plant Pathology Lab detected Fusarium root rot and sudden death disease from an industrial hemp crop, and Fusarium wilt from medical marijuana plants. Here we describe a newly detected hemp disease: Pythium aphanidermatum crown rot.
White Leaf Spot
John McPartland, Karl Hillig
April 2006 Journal of Industrial Hemp 11(1):43-50
DOI: 10.1300/J237v11n01_06
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring color illustrations of signs and symptoms. White leaf spot is caused by a fungus, Phomopsis ganjae.
Signs and symptoms of the disease, life history of the pathogen, differential diagnosis, and control measures are discussed. Disease symptoms and fungus morphology are presented in a series of photographs, each representing approximately one-tenth the scale of the previous photo, to provide an enhanced perspective of scale and proportion
Zur virusanfälligkeit von hanfsorten (Cannabis sativaL.).
Kegler, H., & Spaar, D. (1997).
Archives Of Phytopathology And Plant Protection, 30(5), 457–464.
doi:10.1080/03235409709383198
ON THE VIRUS SUSCEPTIBILITY OF VARIETIES OF CANNABIS SATIVA L. The growing of hemp (Cannabis sativa L.) as a reproducing raw material is increasing in Europe. Investigations concerning the susceptibility of three hemp genotypes to 8 plantpathogenic viruses of various taxonomic groups showed distinct differences
Not cannabis specific
A Low transmissibility of hop latent viroid through a generative phase of Humulus lupulus L.
J.Matousek, J. Patzak
Biologica Plantarium 43 (1): 145-148 (2000)
https://bp.ueb.cas.cz/pdfs/bpl/2000/01/33.pdf
A significant reduction of hop latent viroid (HLVd) content during the generative phase of hop was detected using reverse transcriptase-polymerase chain reaction (RT PRC) and molecular hybridisation methods. A low transmissibility of HLVd through seed may be a feature valuable for the selection and maintenance of viroid-free hybrid hops.
A review of Cannabis sativa-based insecticides, Miticides, and repellents
John McPartland, Zahra Sheikh
Journal of Entomology and Zoology Studies 2018; 6(6): 1288-1299
https://www.researchgate.net/publica...and_repellents
Plant-based pesticides are gaining attention as safe, effective, eco-friendly alternatives to synthetic pesticides. We conducted a literature search regarding the use of hemp (Cannabis sativa) as a plant-based insecticide, miticide, or repellent. The search yielded 88 publications, which we grouped into five types of applications: companion planting (17 articles), the use of harvested plant material without any extraction (25 publications), aqueous extracts (20 publications), essential oil extracts (EOs, nine publications), and solvent extracts (17 publications). Few studies chemically analyzed the contents of their extracts, and most studies lacked control comparisons. EO studies were the most rigorous, and yielded the best results. Results with solvent extracts showed moderate efficacy, but little better than aqueous extracts, which lacked tetrahydrocannabinol (THC). Collectively, the studies suggest that EOs (terpenoids) are the primary Cannabis constituents responsible for arthropod deterrence. THC exerts nominal deterrence, but is toxic to insects. Mechanisms of action are discussed
A Study of Different Disease Detection and Classification Techniques using Deep Learning for Cannabis Plant
Kanaad Pathak, Arti Arya, Prakash Hatti, Vidyadhar Handragal and Kristopher Lee
International Journal of Computing and Digital Systems Int. J. Com. Dig. Sys. 10, No.1 (Jan-2021)
DOI: 10.12785/ijcds/100106
https://journal.uob.edu.bh/bitstream...=4&isAllowed=y
In this paper, different models for disease detection and classification are studied for cannabis plants. Cannabis plants are used for medical and recreational purposes with its recent legalization in some places. Cannabis farmers face problems in cultivation of the crop since it’s susceptible to multiple disorders. With early detection of the disease in the crop it is possible to prevent large waste of yield in the crop. A real dataset is considered for disease detection and classification purposes which is a combination of text and image data and that has been collected over a period of one and a half years (Feb 2018-August 2019). The models used in this study are Fast Region Convolutional Neural Network(F-RCNN), MobileNet Single Shot Multibox Detector(MobileNet-SSD), You Only Look Once(YOLO) and Residual Network-50 Layers (ResNet50). It is found that the MobileNet-SSD provided the best accuracy amongst all the object detection models that are studied and has a lesser training time as well. ResNet 50 is used for identifying the number of images required for a good fit without having to label first and then studied for the object detection models.
Acaricidal properties of hemp (Cannabis sativa L.) essential oil against Dermanyssus gallinae and Hyalomma dromedarii
Mohaddeseh Abouhosseini Tabaria, Aref Khodashenasb, Maryam Jafarib, Riccardo Petrellic, Loredana Cappellaccic, Massimo Nabissic, Filippo Maggic, Roman Pavelad, Mohammad Reza Youssef
Industrial Crops and Products Volume 147, May 2020,
DOI: 10.1016/j.indcrop.2020.112238
The use of conventional pesticides in pest management is facing issues such as developing resistance in pests, environmental pollution and impact on human health, together with regulatory hurdles for approval and marketing of new eco-friendly pesticides to comply with the global trend for residue-free foodstuff. In this framework, botanical pesticides represent valuable alternative products to be exploited. Hemp (Cannabis sativa L.) is an eco-friendly, multipurpose crop that is known for its resistance against insects and parasites. This property is assured by the production of bioactive secondary metabolites such as terpenes and cannabinoids. Notably, the hemp essential oil (EO) contains several terpenoid compounds endowed with pesticide properties. On this basis, in the present work we assayed the toxicity of hemp EO on two ectoparasites of veterinary importance, i.e. Dermanyssus gallinae De Geer and Hyalomma dromedarii Koch. In order to identify the EO chemical constituents responsible for the toxicity on the two ectoparasites, the main monoterpenes and sesquiterpenes of hemp EO, namely ?-pinene, myrcene, (E)-caryophyllene and ?-humulene were tested as well. Mite contact toxicity assays were carried out at the concentrations of 5, 10, 20, 50, 100 and 200 ?g/cm3 . Tick larvicidal and ovicidal assays were done testing 0.5, 1, 2, 5, 10, 20, and 50 ?g/mL of the hemp EO and its main components. Results from mite contact toxicity showed that hemp EO was toxic to D. gallinae with LC50 values of 47.1 ?g/mL. Larvicidal and ovicidal assays revealed the promising activity of the EO against tick larvae and eggs. Among all the tested compounds, (E)–caryophyllene and ?-humulene were the most toxic for both ticks and mites, showing LC50 values lower than the whole EO. Myrcene was moderately toxic, with LC50 values higher than the whole EO, whereas ?-pinene showed weak acaricidal activity. Taken together our results remarked the potential of hemp EO as a potential botanical acaricide in pest management programs and food production. The industrial scalability is assured by the great availability of land for the cultivation of hemp and its low cost of production.
NOT CANNABIS SPECIFIC
Advanced methods of plant disease detection. A review
Federico Martinelli, Riccardo Scalenghe, Salvatore Davino, Stefano Panno, Giuseppe Scuderi, Paolo Ruisi, Paolo Villa, Daniela Stroppiana, Mirco Boschetti, Luiz R. Goulart, et al.
Agronomy for Sustainable Development, Springer Verlag/EDP Sciences/INRA, 2015, 35 (1), pp.1-25.
Doi: 10.1007/s13593-014-0246-1
Plant diseases are responsible for major economic losses in the agricultural industry worldwide. Monitoring plant health and detecting pathogen early are essential to reduce disease spread and facilitate effective management practices. DNA-based and serological methods now provide essential tools for accurate plant disease diagnosis, in addition to the traditional visual scouting for symptoms. Although DNA-based and serological methods have revolutionized plant disease detection, they are not very reliable at asymptomatic stage, especially in case of pathogen with syste
mic diffusion. They need at least 1–2 days for sample harvest, processing, and analysis. Here, we describe modern methods based on nucleic acid and protein analysis. Then, we review innovative approaches currently under development. Our main findings are the following: (1) novel sensors based on the analysis of host responses, e.g., differential mobility spectrometer and lateral flow devices, deliver instantaneous results and can effectively detect early infections directly in the field; (2) biosensors based on phage display and biophotonics can also detect instantaneously infections although they can be integrated with other systems; and (3) remote sensing techniques coupled with spectroscopy-based methods allow high spatialization of results, these techniques may be very useful as a rapid preliminary identification of primary infections. We explain how these tools will help plant disease management and complement serological and DNA-based methods. While serological and PCR-based methods are the most available and effective to confirm disease diagnosis, volatile and biophotonic sensors provide instantaneous results and may be used to identify infections at asymptomatic stages. Remote sensing technologies will be extremely helpful to greatly spatialize diagnostic results. These innovative techniques represent unprecedented tools to render agriculture more sustainable and saffe, avoiding expensive use of pesticides in crop protection.
NOT CANNABIS SPECIFIC
Adventive aphids (Hemiptera: Aphididae) of America North of Mexico
R.G. Foottit, Susan Halbert, Gary L. Miller, L.M. Russell
November 2005 Proceedings- Entomological Society of Washington 108(3) SourceOAI
https://www.researchgate.net/publica...orth_of_Mexico
We provide a compilation of 262 species of aphids that are considered as adventive to North America north of Mexico. Included for each species, where applicable, is reference to: the location and date of introduction of the first North American record; pest status in North America; principal economic hosts; and biogeographical origin. Information is also provided for species whose presence in North America is considered erroneous or questionable and for those species that are considered Holarctic or Beringian.
Agdia ImmunoStrips Testing made easy
Virus test strips
https://www.atzlabs.com/pdf/ImmunoSt...tech_India.pdf
Grow with Confidence Agdia is no stranger to understanding how confidence can impact your business. Customers must be confident they are buying quality products; otherwise, they will look for alternatives. In order to ensure customers receive a quality product, the supplier must be confident that they have all the tools necessary to produce it. In the case of crop production, plant disease can have negative impacts on both a grower’s confidence and their reputation. Since 1981, Agdia has been dedicated to helping growers manage plant disease through early and routine diagnosis of plant pathogens. Today, we are the leading provider of plant disease diagnostics in the industry with a comprehensive line of testing products that are used world-wide. We realize you have options when it comes to diagnostic providers. If you want to work with a testing provider that was built and has grown on the principle of confidence, test with Agdia
An Overview of Hemp Diseases
Journal of the Institute of Science and Technology June 2020 (in Turkish)
Mehmet Ali Sevik
DOI: 10.21597/jist.670642
https://www.researchgate.net/publica..._Hemp_Diseases
Industrial hemp (Cannabis sativa var. vulgaris L.), a variant of the C. sativa plant, is an important industrial crop. Industrial hemp is one of the oldest crops plants know to humans. Hemp is very sensitive to environmental conditions, diseases, and pests. Environmentally stressed plants become predisposed to diseases. Diseases of Cannabis are caused by biotic (bacteria, fungi, viruses, viroids, phytoplasmas) or abiotic (nutrient deficiencies) sources. Cannabis species suffer over 100 diseases. Disease prevalence is also varied by geography and climate. Serious fungal diseases on hemp include gray mold, hemp canker, damping off, assorted leaf spots, blights, root rots. Important bacterial diseases include bacterial blight, wilt, crown gall, striatura ulcerosa, and xanthomonas leaf spot. In Cannabis cultivars were reported including the diseases caused by Hemp streak virus (HSV), Hemp mosaic virus (HMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), and Arabis mosaic virus (ArMV). Important diseases affecting the hemp crop along with their symptoms, means of movement and dispersal, and management are briefly summarized in the paper.
An overview of pathogen and insect threats to fibre and oilseed hemp (Cannabis sativa L.) and methods for their biocontrol
Malgorzata Jedryczka, Fatema Bakro, Katarzyna Wielgusz, Marek Bunalski
Integrated Control in Oilseed Crops IOBC-WPRS Bulletin Vol. 136, 2018 pp. 9-20 September 2018
https://www.researchgate.net/publica...eir_biocontrol
Hemp (Cannabis sativa L.) is a treasure trove plant for both sustainable agriculture and industrial usage. It has multi-application properties due to the production of fibre and high quality oil, biomass as a safe source of energy, and numerous compounds for the pharmaceutical sectors, including mainly cannabinoids (THC and CBD) which have a wide range of psychotropic activities. Hemp, like other plants, suffers from a wide range of pests and pathogens. They cause plant damage, huge annual loss of biomass and seed yield as well as the reduction of the quality of the products. With increased demand for hemp products, its production area is anticipated to expand greatly; previously developed tolerance of environmental pressures or defense mechanisms against biotic threats may not meet the demands of new environments and the additional pathogens that will be encountered. In this review we focus on the most common fungal, oomycetes, viral and pest diseases attacking hemp both worldwide and in Poland. We also highlight the methods of biological control that make possible the maintenance healthy plants as well as the high quality of hemp products.
Not Cannabis specific
Analysis of Cryptic, Systemic Botrytis Infections in Symptomless Hosts
Michael W. Shaw, Christy J. Emmanuel, Deni Emilda, Razak B. Terhem, Aminath Shafia, Dimitra Tsamaidi, Mark Emblow and Jan A. L. van Kan
Frontiers in Plant Science, 7 2016
doi: 10.3389/fpls.2016.00625
Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. Botrytis cinerea and Botrytis pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents) when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles.
Apparent Increase in Biomass and Seed Productivity in Hemp (Cannabis sativa) Resulting from Branch Proliferation Caused by the European Corn Borer (Ostrinia nubilalis)
Ernest Small, David Marcus, Gail Butler, A. R. McElroy
May 2007 Journal of Industrial Hemp 12(1):15-26
DOI: 10.1300/J237v12n01_03
The European corn borer (Ostrinia nubilalis Hübner), or
ECB, is a major pest of hemp (Cannabis sativa L.). During the course of a study of hemp germplasm and cultivar accessions, the ECB attacked the vertical stem leader of hundreds of plants. At the site of invasion the main stem was typically destroyed, and the plant became strongly branched. Although the damaged plants were an average 9% shorter, mean shoot weight was 20% heavier. Seed productivity was also greater, based on a visual scale. The practical significance of such an “overcompensation” response to insect damage, with damaged plants growing more robustly and productively than their undamaged counterparts, is controversial. Certainly, some aspects of productivity, such as fibre quality, are detrimentally affected by the ECB. The insect showed a preference for larger plants, but was indifferent to the level of tetrahydrocannabinol, the chief intoxicant of C. sativa.
Arthropod pests of hemp (Cannabis sativa L.)
Peter A. Edde
In book: Field Crop Arthropod Pests of Economic Importance January 2022 pg 915-952
DOI: 10.1016/B978-0-12-818621-3.00012-4
https://www.researchgate.net/publica...a_L/references
Hemp is a member of the Cannabaceae family in the rose order (Rosales). Cannabaceae currently contains approximately 11 genera and 170 species of plants. Cannabis and hops ( Humulus ) are the most economically important members of the family. The term “hemp,” has been used broadly to describe many different plant species from several genera and families producing bast fibers, all similar in appearance and quality. Among these are sunn hemp, produced from Crotalaria juncea L. (Fabaceae); sisal hemp, obtained from leaves of Agave sisalana Perrine (Asparagaceae); Manila hemp (abaca), derived from the leaf stalks of Musa textilis Née (Musaceae); Mauritius hemp, obtained from green aloe, Furcraea foetida (L.) Haw (Asparagaceae); and India hemp, produced from plants in the genus Corchorus (Malvaceae). The true hemp plant, Cannabis sativa L., is cultivated chiefly for its fiber, but the seed is used for medicinal and narcotic purposes.
There are three distinct types of cultivated hemp, each further subdivided into varieties. One type of hemp is grown for fiber. Depending on variety, hemp grown for fiber are high in cellulose with stalks up to 4.9 m high. A second type is cultivated for fruit (or seed), which is utilized as a source of oil and food due to its high digestible protein and essential fatty acid content. A third type of hemp, Cannabis sativa, var. indica is high in alkaloids called cannabinoids. The cannabinoids are derived from the dried inflorescences and upper leaves of the carpellate plant. The plant has medicinal and narcotic properties ( Small & Marcus, 2002 ). The common names hemp and marijuana are associated with all three forms
Bacterial leaf spot of hemp caused by Xanthomonas campestris pv. cannabis in Japan.
Netsu, O., Kijima, T., & Takikawa, Y.
Journal of General Plant Pathology, 80(2), 164–168. (2013).
doi:10.1007/s10327-013-0497-8
Bacterial leaf spot disease of hemp was observed in Tochigi Prefecture, Japan in 1982 and characterized by necrotic lesions ca. 1–2 mm diameter on leaves with a yellow halo 2–3 mm wide. In this report, we describe the pathological, physiological and genetic properties of the causal bacterium. Our results indicated that this bacterium is identical with Xanthomonas campestris pv. cannabis reported in Romania.
... cannabis is still obscure. When Vauterin et al. (1995) proposed a new species of Xanthomonas as a result of DNA–DNA hybridization studies, pv. cannabis was left unclassified, and the combination of the name X. campestris pv. can- nabis remained (Bull et al. 2010a). .
Bacteriological and cannabinoids analysis
Dr. José Carlos Bouso
https://www.fundacion-canna.es/en/ba...noids-analysis
The main sanitary problem the users of ilegal drugs in general, and Cannabis users in particular, face, is that there are several unknown factors about the product they are consuming, such as: 1. the manufacturing and/or cultivation processes; 2. the purity, agglutinative and other chemical and/or biologic products present; 3. the effects of such products over heath; and 4. how it has been handled, preserved and sold.
Beet Curly Top Virus In Cannabis
YouTube
Most Curtoviruses are one of three Curly Top Virus species
(BCTV) Beet Curly Top Virus
(SpSCTV) Spinach Severe Surley Top Virus
(HrCTV) Horseradish Curly Top Virus
Curtovirus sequences with>77% genome-wide pairwise identity would be classified as belonging to the same species, those sharing >94% identity would be classified as belonging to the strain.
Beneficial Insects for Biological Pest Control in Greenhouse Cannabis Production
Gerasimos Grammenos, Varvara Kouneli, Antonios Kouneli, D Bilalis
Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Horticulture 78(2):85-93 Nov 2021
https://www.researchgate.net/publica...bis_Production (check http)
DOI: 10.15835/buasvmcn-hort:2021.0037
A greenhouse cannabis cultivation took place in Agriculture university of Athens in order to quantify the efficiency of beneficial insects as a main method of pest management. Cannabis plants grown in two greenhouses and beneficial insects were released only in one greenhouse as a means to investigate the efficacy against pests by the comparison with the control greenhouse. Measurements included the visual estimation of infestation, the recording of pest species and populations, and the comparison of infestations and yields amongst greenhouses. Our results indicate that beneficial insects could control pest populations up to 100%. Even though the environmental conditions were not optimal and consecutive pest infestations were observed throughout the duration of our study, the beneficial insects successfully managed the pest populations. In conclusion, biological control with beneficial insects is a very effective method for pest management in greenhouse cannabis production
Bibenzyl synthesis in Cannabis sativa L.
Kelly F. Boddington,Eric Soubeyrand,Kristen Van Gelder,José A. Casaretto,Colby Perrin,Taylor J.B. Forrester,Cameron Parry,M. Sameer Al-Abdul-Wahid,Nicholas G. Jentsch,Jakob Magolan,Gale G. Bozzo,Matthew S. Kimber,Steven J. Rothstein,Tariq A. Akhtar
The Plant Journal Nov 2021
DOI: 10.1111/tpj.15588
https://onlinelibrary.wiley.com/doi/10.1111/tpj.15588
This study focuses on the biosynthesis of a suite of specialized metabolites fromCannabis that are known as the ‘bibenzyls’. In planta, bibenzyls accumulate in response to fungal infection and various other biotic stressors; however, it is their widely recognized anti-inflammatory properties in various animal cell models that have garnered recent therapeutic interest. We propose that these compounds are synthesized via a branch point from the core phenylpropanoid pathway in Cannabis, in a three-step sequence. First, various hydroxycinnamic acids are esterified to acyl-coenzyme A (CoA) by a member of the 4-coumarate-CoA ligase family (Cs4CL4). Next, these CoA esters are reduced by two double-bond reductases (CsDBR2 and CsDBR3) that form their corresponding dihydro-CoA derivatives from preferred substrates. Finally, the bibenzyl backbone is completed by a polyketide synthase that specifically condenses malonyl-CoA with these dihydro-hydroxycinnamoyl-CoA derivatives to form two bibenzyl scaffolds: dihydropiceatannol and dihydroresveratrol. Structural determination of this ‘bibenzyl synthase’ enzyme (CsBBS2) indicates that a narrowing of the hydrophobic pocket surrounding the active site evolved to sterically favor the non-canonical and more flexible dihydro-hydroxycinnamoyl-CoA substrates in comparison with their oxidized relatives. Accordingly, three point mutations that were introduced into CsBBS2 proved sufficient to restore some enzymatic activity with an oxidized substrate, in vitro. Together, the identification of this set of Cannabis enzymes provides a valuable contribution to the growing ‘parts prospecting’ inventory that supports the rational metabolic engineering of natural product therapeutics.
Biocontrol Activity of Bacillus spp. and Pseudomonasspp. Against Botrytis cinerea and Other Cannabis Fungal Pathogens
Carole Balthazar, Amy Novinscak, Gabrielle Cantin, David L. Joly, Martin Filion.
Pathology 2021 July 2021
Doi: 10.1094/PHYTO-03-21-0128-R
Gray mold caused by Botrytis cinerea is one of the most widespread and damaging diseases in cannabis crops worldwide. With challenging restrictions on pesticide use and few effective control measures, biocontrol agents are needed to manage this disease. The aim of this study was to identify and characterize bacterial biocontrol agents with wide-spectrum activity against B. cinerea and other major cannabis fungal pathogens. Twelve Bacillus and Pseudomonas strains were first screened with in vitro confrontational assays against ten culturable cannabis pathogens, namely B. cinerea,Sclerotinia sclerotiorum, Fusarium culmorum, F. sporotrichoides, F. oxysporum, Nigrospora sphaerica, N. oryzae, Alternaria alternata, Phoma sp. and Cercospora sp. Six strains displaying the highest inhibitory activity, namely B. velezensis LBUM279, FZB42, LBUM1082, B. subtilis LBUM979, P. synxantha LBUM223, and P. protegens Pf-5, were further assessed in planta where all, except LBUM223, significantly controlled gray mold development on cannabis leaves. Notably, LBUM279 and FZB42 reduced disease severity by at least half compared to water-treated plants and prevented lesion development and/or sporulation up to 9 days following pathogen inoculation. Genomes of LBUM279, LBUM1082 and LBUM979 were sequenced de novo and taxonomic affiliations were determined to ensure non-relatedness with pathogenic strains. Moreover, the genomes were exempt of detrimental genes encoding major toxins and virulence factors that could otherwise pose a biosafety risk when used on crops. Eighteen gene clusters of potential biocontrol interest were also identified. To our knowledge, this is the first reported attempt to control cannabis fungal diseases in planta by direct antagonism with beneficial bacteria.
Find PDF
Biocontrol agents and their influence on the cannabis testing space
Kevin McKernan, Kristofer Marsh, Steve Cottrell, Sherman Hom
https://osf.io/cn9y4/download https://osf.io/preprints/cn9y4/
Biocontrol agents are a promising and mature agricultural technology that offer a more environmentally friendly solution to controlling pathogenic microbial risks found on agricultural products than the conventional use of chemical pesticides[1]. Often, the application of nonpathogenic or atoxigenic microbial strains can help to outcompete pathogenic microbes in a given niche[2,3]. The genomes of these biocontrol organisms are often modified to eliminate the production of the toxin[4]. This genome driven approach can reduce or even eliminate the use of pesticides or fungicides[3]. Agricultural markets that utilize extraction techniques to concentrate particular resins or nutrients are often drawn to biocontrol approaches as some pesticides and fungicides are known to become enriched during extraction process while the biocontrol agents are often eliminated[5,6]. Nevertheless, some states have microbial testing regulations that inadvertently ban the use of biocontrol agents through the use of non-specific Total Yeast and Mold (TYM) or Total Aerobic Count (TAC) testing. These tests do not discriminate between commonly used biocontrol agents (like bacillus amyloliquefaciens) and pathogenic risks. Bacillus amyloliquefaciens has even been shown to liquify some petri dish plates, further elevating the plate counts[7]. Many states have retired these tests citing the lack of clinical utility and their arbitrary action limits and actionability. This has led some states where cannabis is regulated to implement species specific testing for Aspergillus, E.coli and Salmonella (Figure 1).
BIOLOGICAL CONTROL ORGANISMS FOR INSECTS AND MITES
Whitney Cranshaw, Austin Broberg, and Wendlin Burns
https://webdoc.agsci.colostate.edu/h...iers%20NEW.pdf
A wide variety of beneficial organisms are offered for sale by several suppliers to assist in management of insects and mites. The following is a listing of most of the US suppliers and it is organized into three sections. First is a brief description of organisms with potential applications followed by reference to sources where they may be purchased. This is followed by a brief summary listing of pest groups and the associated potential biological controls. At the end is a listing of addresses of many suppliers/producers
Biotic stress caused by Tetranychus urticae mites elevates the quantity of secondary metabolites cannabinoids and terpenes in Cannabis sativa L
Elizabeth Kostanda, Soliman Khatib
Industrial Crops and Products ( IF 5.645 ) Pub Date : 2021-12-16 ,
DOI: 10.1016/j.indcrop.2021.114331
Secondary metabolites are known to play a role in the plant's defense system, which can be triggered by biotic or abiotic stress. Cannabis (Cannabis sativa L.) plants and mainly their female flowers, have a variety of bioactive metabolites, predominantly cannabinoids and terpenes, which are synthesized and secreted by the trichomes. Many studies have examined their chemistry and bioactive effects; however, there is insufficient information on the effect of biotic stress on the presence of secondary metabolites in cannabis. The present study examined the effect of a well-known cannabis pest,Tetranychus urticae, on the occurrence and concentration of cannabinoids and terpenes in cannabis leaves and flowers. Six cannabis plants were infested with T. urticae mites (treatment group), and six plants were used as the control group. Cannabinoids and terpenes were analyzed and quantified by liquid chromatograph mass spectrometer and gas chromatograph mass spectrometer, respectively. The contents of several cannabinoids and terpenes increased significantly in the leaves of the treatment group of plants in their late vegetative phase as the mite population increased, compared with the control group. Significantly increased content of almost all terpenes, and the cannabinoids; Δ9-tetrahydrocannabinol, cannabichromene, and cannabigerol, was also seen in mature flowers of the treatment group plants, compared with the control group. Thus, cannabis plant infestation has an impact on its secondary metabolites, cannabinoids and terpenes, reflected by an overall increase in these compounds.
Find Pdf
Not Cannabis Specific
Can UVB Light Control Mold And Powdery Mildew?
California Lightworks September 17, 2019
https://news.californialightworks.co.. .owdery-mildew/
A fungal infestation can be massively devastating to a dedicated grower. After putting in your best efforts to cultivate a quality product under ideal growing conditions, it can be heartbreaking to see your plants destroyed by a relentless fungus.
And for many growers, spraying their grow room with nasty fungicides doesn’t feel like the ideal option, either.
This is why many gardeners are increasingly interested in UV light as a method for controlling mold and powdery mildew. If a simple light could help you save your plants from an untimely end, wouldn’t that be the best option? You would keep toxins out of the air and save yourself the expense and heartache of unusable plants.
Candidatus Phytoplasma asteris’ (group 16SrI) associated with a witches’?broom disease of Cannabis sativa in India
S. K. Raj, S. K. Snehi, M. S. Khan, S. Kumar
Plant Pathology, 57(6), 1173–1173. (2008).
doi:10.1111/j.1365-3059.2008.01920.x
Cannabis sativa, known as hemp, family Cannabaceae, occurs wild through out Himalayas and is cultivated in some provinces of India as a source of narcotic resin, fibre and edible oil (Anonymous, 1992). Symptoms of witches’ broom, similar to those associated with phytoplasmas, were observed in C. sativa plants growing wild along roadsides in Lakhimpur-Kheri, U.P., India during the summer of 2007. The diseased plants exhibited proliferation of branches with shortened internodes and reduced-size leaves , giving rise to the witches’ broom appearance. Total DNA was extracted from leaves of three symptom and three symptomless C. sativa plants. Nested PCR was carried out using P1/P6 (Deng & Hiruki, 1991) and R16F2n/R16R2 (Gundersen & Lee, 1996) universal primers specific to the phytoplasma 16S rRNA gene. PCR products of the expected size, ~1·5 kb and ~1·2 kb, respectively, were obtained from all plant samples with symptoms (3/3) but not from healthy ones. The three amplicons of 1·2 kb were sequenced and sequence data deposited in GenBank (Accession No. EU439257). BLAST search analysis of the 16S rRNA sequence of the C. sativa phytoplasma showed a 99% identity with those of phytoplasma members of 16SrI group, ‘Candidatus Phytoplasma asteris’, associated with periwinkle little leaf (EU375834); onion yellows (AP006628); carrot phytoplasma (EU215426); barley deformation (AY734453); and aster yellows (AY665676). Therefore, the C. sativa phytoplasma was identified as an isolate of the 16SrI group. A witches’ broom disease on a Cannabis sp. has been recently associated with a phytoplasma of elm yellows group (16SrV) in China (Zhao et al., 2007), but this is the first report of a 16SrI phytoplasma associated with witches’ broom on C. sativa in India.
Cannabinoid Receptors Are Absent in Insects
JOHN MCPARTLAND, VINCENZO DI MARZO, LUCIANO DE PETROCELLIS, LISON MERCER, AND MICHELLE GLASS
THE JOURNAL OF COMPARATIVE NEUROLOGY 436:423–429 (2001)
doi: 10.1002/cne.1078
The endocannabinoid system exerts an important neuromodulatory role in mammals. Knockout mice lacking cannabinoid (CB) receptors exhibit significant morbidity. The endocannabinoid system also appears to be phylogenetically ancient—it occurs in mammals, birds, amphibians, fish, sea urchins, leeches, mussels, and even the most primitive animal with a nerve network, the Hydra. The presence of CB receptors, however, has not been examined in terrestrial invertebrates (or any member of the Ecdysozoa). Surprisingly, we found no specific binding of the synthetic CB ligands [3
H]CP55,940 and [3 H]SR141716A in a panel of insects: Apis mellifera, Drosophila melanogaster, Gerris marginatus, Spodoptera frugiperda, and Zophobas atratus. A lack of functional CB receptors was confirmed by the inability of tetrahydrocannabinol (THC) and HU210 to activate G-proteins in insect tissues, utilizing a guanosine-59-O-(3-[35]thio)-triphosphate (GTPgS) assay. No orthologs of human CB receptors were located in the Drosophila genome, nor did we find orthologs of fatty acid amide hydrolase. This loss of CB receptors appears to be unique in the field of comparative
neurobiology. No other known mammalian neuroreceptor is understood to be missing in insects. We hypothesized that CB receptors were lost in insects because of a dearth of ligands; endogenous CB ligands are metabolites of arachidonic acid, and insects produce little or no arachidonic acid or endocannabinoid ligands, such as anandamide
Cannabis Crop Recommendation
Evergreen Growers Supply, LLC
https://www.evergreengrowers.com/med...endations.html
https://www.evergreengrowers.com/fil...1454530813.pdf
Cannabis, or marijuana, is grown for human consumption and therefore every effort should be made to grow the crop without the use of potentially harmful pesticides. Using beneficial insects and natural fungi to eliminate pests is the best way to ensure the cultivation of a clean and quality product for customers and/or patients.
Intensive modern breeding programs for medicinal characteristics have shifted cultivation from traditional, outdoor environments toward protected, indoor environments. Choosing to work indoors gives growers the ability to grow cannabis year-round and at a faster rate, but it also leaves their crops more susceptible to damaging pests. By creating a nurturing environment for their plants and eliminating the possibility of natural pests from outside, indoor growers inadvertently create very inviting breeding grounds for devastating pests.
Because cannabis has been mostly cultivated as a field crop, indoor growers often experience “stressed” plants which attract fungal pathogens and insect pests. Growers should do what they can to minimize stress by being proactive and working to prevent pests before they become a problem.
Cannabis Microbiome Sequencing: Implications for Cannabis Safety Testing
Kyle Boyar
DOI: 10.13140/RG.2.2.18308.17288
Conference: Cannabis Science Conference East April 2019
The cannabis plant and cannabis products are highly varied and complex matrices with each different product and route of administration having its own considerations for microbial testing. In the absence of rigorous study, this immature industry has decided to adopt methods commonly used in food testing to obtain information about the potential microbial hazards present. However, DNA sequencing of both the cannabis microbiome and the conditions before and after culturing tell a tale of inaccurate methodology. Many of the methods that are currently being employed are leading the cannabis industry astray, while blinding them to the real hazards that could be present. This presentation will walk you through the data that shows this and the discoveries we've made along the way that will hopefully open fresh discussions with new perspective on how to tackle microbiological contaminants in cannabis.
Cannabis microbiome sequencing reveals Penicillum Paxilli and the potential for Paxilline drug interactions with Cannabidiol
Kevin McKernan, Jessica Spangler, Yvonne Helbert, Ryan Lynch, Adrian Devitt-Lee, Wendell Orphe, Ted Foss, Chris Hudalla, Matthew Silva, Cindy Orser, Douglas Smith
https://www.medicinalgenomics.com/wp...4.06.15-pm.png
https://www.medicinalgenomics.com/wp...6_edits_v8.pdf
Traditional Cannabis microbial safety testing relies on counting colony forming units (CFU/g) that grow on a petri dish, 3M film or in a culture based system (Marcu, 2013). These systems take 3-5 days to culture fungi or microbes to detectable limits and cannot discern harmful microbes from beneficial microbes and often fail to detect fungi that synthesize compounds contra-indicated in the medicinal use of cannabinoids (McKernan et al.). As a result of this lack of specificity, overuse of fungicides is common in Colorado and California in 2016 (Wurzer, 2016).
An ideal microbial detection system would discern pathogenic from beneficial microbes. This can be challenging to do with selective medias and culturing conditions but can easily be accomplished with DNA based methods. We propose a 2 step method that first depletes or captures beneficial microbial DNA (Bacillus, Trichoderma etc.) onto a magnetic particle.
The supernatant of this particle thus contains the nonbeneficial microbes and can be tested by qPCR using ITS primers, as described in McKernan et al.
Cannabis microbiome sequencing reveals several mycotoxic fungi native to dispensary grade Cannabis flowers
DOI: 10.12688/f1000research.7507.2
https://biorxiv.org/content/biorxiv/e...30775.full.pdf
https://f1000research.com/articles/4-1422/v2
The Center for Disease Control estimates 128,000 people in the U.S. are hospitalized annually due to food borne illnesses. This has created a demand for food safety testing targeting the detection of pathogenic mold and bacteria on agricultural products. This risk extends to medical Cannabis and is of particular concern with inhaled, vaporized and even concentrated Cannabis products . As a result, third party microbial testing has become a regulatory requirement in the medical and recreational Cannabis markets, yet knowledge of the Cannabis microbiome is limited. Here we describe the first next generation sequencing survey of the fungal communities found in dispensary based Cannabis flowers by ITS2 sequencing, and demonstrate the sensitive detection of several toxigenic Penicillium and Aspergillus species, including P. citrinum and P. paxilli, that were not detected by one or more culture-based methods currently in use for safety testing.
Cannabis pathogens XI: Septoria spp. on Cannabis sativa, sensu stricto
John M. McPartland
Sydowia. 47:44-53 (1995)
https://www.zobodat.at/pdf/Sydowia_47_0044-0053.pdf
The genus Septoria Saccardo is quite unwieldy, containing about 2000 taxa. Sutton (1980) notes some workers have subdivided and studied the genus by geographical area. Grouping Septoria spp. by their host range is a more natural way of studying the genus in surmountable subunits. Six previous papers have revised Septoria spp. based on host studies (Punithalingham & Wheeler, 1965; Constantinescu, 1984; Sutton & Pascoe, 1987; Farr, 1991, 1992a, 1992b). Their results suggest Septoria host ranges are limited, and support the continued study of Septoria by host groupings. These compilations and comparisons are especially useful when cultures are lacking
Cannabis sativa as a Host of Rice Root Aphid (Hemiptera: Aphididae) in North America
Whitney Cranshaw, Suzanne Wainwright-Evans
Journal of Integrated Pest Management, Volume 11, Issue 1, 2020, 15,
DOI: 10.1093/jipm/pmaa008
Rice root aphid, Rhopalosiphum rufiabdominale (Sasaki), is a cosmopolitan species widespread in North America. Most records of this insect are of its association with roots of grasses and sedges, but known hosts also include numerous broadleaved plants both grown outdoors and in greenhouses. Indoor grown Cannabis sativa L., particularly when intensively grown for marijuana production, has also emerged as a common host for this insect in the United States and Canada. On this crop, it has an anholocyclic life cycle where it is almost entirely found in association with plant roots. Colonization of new plants is largely by alate forms that may emerge from soil in large numbers as plants near maturity.
Canmed Events Podcasts web talks
https://cannmedevents.com/coffee-tal...ource=hs_email
Characterization and pathogenicity of Fusarium solani causing foot rot on hemp (Cannabis sativa L.) in Southern Italy.
Sorrentino, R., Pergamo, R., Battaglia, V., Raimo, F., Cermola, M., & Lahoz, E.
Journal of Plant Diseases and Protection. (2019).
doi:10.1007/s41348-019-00265-1
Symptoms of foot rot were observed on hemp (Cannabis sativa) plants in Campania region (Southern Italy) in 2018. The symptoms consisted of brownish areas along the main stem followed by wilting and dropping of leaves. The bark was easily removed in correspondence of the lesions since the inner part of the cortex was afected too. The causal agent was isolated on potato dextrose agar and stored at the Research Centre for Cereal and Industrial Crops of Caserta. On carnation leaf agar, the fungus produced long monophialidic conidiogenous cells and both micro- and macroconidia. The frst were oval, ellipsoid and fusiform prevalently 0- and 1-septate with length 9.84–12.68 ?m and width 2.61–4.15 ?m, while falciform macroconidia were prevalently 3- and 4-septate with length and width 23.87–29.23×3.22–4.98, respectively. Chlamydospores were observed intercalated in the hyphae, globose to oval in shape with smooth or rough wall, 5–15 ?m in diameter. Morphologically, the fungus was identifed as Fusarium solani, which was also supported by the BLASTn and the phylogenetic analysis of the sequences of the internal transcribed spacer and elongation factor 1-? genes. Koch’s postulates confrmed F. solani as the etiological agent of the observed disease. Cluster analysis applied to the two genes demonstrated that our isolates belong to the clade 3 of the F. solani species complex.
Characterization of Stolbur (16SrXII) Group Phytoplasmas Associated with Cannabis sativa Witches'-broom Disease in Iran
Fereshteh Vali Sichani, Masoud Bahar and Leila Zirak
Plant Pathology Journal 2011 Volume:10 Issue:4 Page 161-167
DOI: 10.3923/ppj.2011.161.167
A new disease of hemp plants characterized by witches'-brooms and stunting symptoms was appeared in Yazd province in the centre of Iran. Phytoplasma infections were detected in symptomatic hemps by polymerase chain reaction (PCR) amplifications using phytoplasma universal primer pair P1/P7 followed by R16F2n/R16R2 in nested PCR. Restriction fragments length polymorphism (RFLP) analysis results using CfoI restriction enzyme confirmed that the hemp witches'-broom phytoplasma isolates are related to stolbur group. Also, virtual RFLP analysis revealed that hemp witches'-broom phyutoplasmas in Iran are different from members of other 16SrXII subgroups. Sequence analysis of partial 16S rRNA gene indicated that the phytoplasmas associated with hemp in Iran shared high similarity with ‘Candidatus Phytoplasma solani’ and other phytoplasmas related to stolbur group. This research is the first report of hemp infection with phytoplasmas related to stolbur group.
Coffee Talk With Dr David Joly about PM genes and how to breed Cannabis with them.
https://cannmedevents.com/2021/09/29...d-joly-phd/?ut
• How PM infects cannabis plants and how environmental conditions play a role
• The prevention and remediation options cannabis cultivators currently have
• The difference between PM resistance and PM susceptibility and how variations both can affect the severity of infection
• How breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
• What are MLO genes and how do they affect PM susceptibility
• How MLO genes were used to breed our PM susceptibility in other crops
• The importance of having a quality reference genome to investigate genes of interest.
Comparative genomics of a cannabis pathogen reveals insight into the evolution of pathogenicity in Xanthomonas.
Jacobs, J. M., Pesce, Cã©., Lefeuvre, P., & Koebnik, R.
Frontiers in Plant Science, 6. (2015).
doi:10.3389/fpls.2015.00431
Pathogenic bacteria in the genus Xanthomonas cause diseases on over 350 plant species, including cannabis (Cannabis sativa L.). Because of regulatory limitations, the biology of the Xanthomonas-cannabis pathosystem remains largely unexplored. To gain insight into the evolution of Xanthomonas strains pathogenic to cannabis, we sequenced the genomes of two geographically distinct Xanthomonas strains, NCPPB 3753 and NCPPB 2877, which were previously isolated from symptomatic plant tissue in Japan and Romania. Comparative multilocus sequence analysis of housekeeping
genes revealed that they belong to Group 2, which comprises most of the described species of Xanthomonas. Interestingly, both strains lack the Hrp Type III secretion system and do not contain any of the known Type III effectors. Yet their genomes notably encode two key Hrp pathogenicity regulators HrpG and HrpX, and hrpG and hrpX are in the same genetic organization as in the other Group 2 xanthomonads. Promoter prediction of HrpX-regulated genes suggests the induction of an aminopeptidase, a lipase and two polygalacturonases upon plant colonization, similar to other plantpathogenic xanthomonads. Genome analysis of the distantly related Xanthomonas maliensis strain 97M, which was isolated from a rice leaf in Mali, similarly demonstrated the presence of HrpG, HrpX, and a HrpX-regulated polygalacturonase, and the absence of the Hrp Type III secretion system and known Type III effectors. Given the observation that some Xanthomonas strains across distinct taxa do not contain hrpG and hrpX, we speculate a stepwise evolution of pathogenicity, which involves (i) acquisition of key regulatory genes and cell wall-degrading enzymes, followed by (ii) acquisition of the Hrp Type III secretion system, which is ultimately accompanied by (iii) successive acquisition of Type III effectors.
NOT CANNABIS SPECIFIC but this virus is found in Cannabis
Complete Genome Sequence of a Hop Latent Virus Infecting Hop Plants
Yeonhwa Jo, Hoseong Choi, and Won Kyong Chocorresponding author
Genome Announc. 2015 Mar-Apr; 3(2): e00302-15.
doi: 10.1128/genomeA.00302-15
he hop latent virus is a single-stranded RNA virus that mainly infects hop plants. Here, we report the complete genome sequence of a hop latent virus, which was de novo assembled by RNA sequencing (RNA-seq). Our study indicates that transcriptome data are useful for identifying a complete viral genome
Complete sequence of a cryptic virus from hemp (Cannabis sativa)
Angelika Ziegler • Jaroslav Matous?ek • Gerhard Steger • Jorg Schubert
Arch Virol
DOI 10.1007/s00705-011-1168-8
Hemp (Cannabis sativa) was found to be a useful propagation host for hop latent virus, a carlavirus. However, when virus preparations were analysed by electron microscopy, along with the expected filamentous particles, spherical particles with a diameter of around 34 nm were found. RNA from virus preparations was purified, and cDNA was prepared and cloned. Sequence information was used to search databases, and the greatest similarity was found with Primula malacoides virus 1, a putative new member of the genus Partitivirus. The full sequences of RNA 1 and RNA 2 of this new hemp cryptic virus were obtained.
Contrasting Roles of Cannabidiol as an Insecticide and Rescuing Agent for Ethanol–induced Death in the Tobacco Hornworm Manduca sexta.
Park, S.-H., Staples, S. K., Gostin, E. L., Smith, J. P., Vigil, J. J., Seifried, D., … Heuvel, B. D. V.
Scientific Reports, 9(1). (2019).
doi:10.1038/s41598-019-47017-7
Cannabis sativa, also known as marijuana or hemp, produces a non-psychoactive compound cannabidiol (CBD). To investigate the defensive role of CBD, a feeding preference assay was performed with tobacco hornworm Manduca sexta. The larvae clearly show feeding preference towards the Cannabis tissue containing low CBD over high CBD. While the larva avoided the high CBD diet, we investigated detrimental efects of CBD in the insects’ diet. Contrasted to the performance on low CBD-infused artifcial diet (AD), larvae reared on the high CBD diet sufer signifcantly reduced growth and increased mortality. Through testing diferent carriers, we found that the increase of EtOH in the diet is negatively correlated with insect development and behaviors. Notably, CBD treatment signifcantly improved ethanol-intoxicated larval survival rate by 40% and also improved diet searching activity, resulting in increased diet consumption. Electrophysiology results revealed that the CBD-treated ganglia had delayed but much larger response with electric stimuli in comparison to the larvae reared on AD only and EtOH-added diet. Our results show CBDs’ defensive role against pest insects, which suggests its possible use as an insecticide. We also provide evidence that CBD alleviates alcohol-induced stress; consequently, improving the performance and viability of M. sexta larvae.
Cross-Infectivity of Powdery Mildew Isolates Originating from Hemp (Cannabis sativa) and Japanese Hop (Humulus japonicus) in New York.
Weldon, W. A., Ullrich, M. R., Smart, L. B., Smart, C. D., & Gadoury, D. M.
Plant Health Progress, 47–53.(2020).
doi:10.1094/php-09-19-0067-rs
In the recent decade, agricultural production of both hemp (Cannabis sativa) and hop (Humulus lupulus) has expanded throughout the Pacific Northwest, Midwest, and Eastern United States to support the growing industries for which these plants are key components. The significant and rapidly expanding overlap of production regions of these two Cannabaceae plant family members creates a potential dispersal route for organisms that are pathogenic to both hosts. Powdery mildew is a disease of high economic impact in both hemp and hop production systems, yet it was largely unknown whether the powdery mildew fungi commonly associated with hemp could also be pathogenic on hop, and vice versa. We isolated Golovinomyces spadiceusgrowing upon hemp in New York production greenhouses and Podosphaera macularisfrom feral hop (H. japonicus) plantings also in New York. Herein, we report the pathogenicity of P. macularis associated with hop to C. sativa cultivars ‘Anka’ and ‘Wild Horse’ and pathogenicity of G. spadiceus toward hop. The potential for P. macularis to establish, produce viable, infectious conidia, and undergo sexual recombination on hemp could complicate efforts to exclude the MAT1-2 mating type of P. macularis from western North America and could facilitate the spread of races pathogenic toward ‘Cascade’ hop, and hop cultivars with R6-based resistance to P. macularis, including ‘Nugget’. Further assessment of the pathogenicity of diverse P. macularis isolates, in both geographic origin and the range of hop species, is necessary to better understand the dispersal risk of P. macularis on hemp.
Dark Heart Nursery Identifies Major Virus Behind ‘Dud’ Cannabis Plants
https://cannabisnow.com/dark-heart-n...nnabis-plants/
Dark Heart Nursery has identified that the HpLVd virus — said to infect up to 30 percent of crops — causes cannabis plants to grow poorly.
Jimi Devine
In an announcement likely to send shockwaves through the cannabis industry, Dark Heart Nursery announced on Thursday it had positively identified hop latent viroid (HpLVd) as the cause of “dudding” in cannabis plants, resulting in lost vigor.
After identifying HpLVd is the culprit behind poor cannabis plant performance, Dark Heart started testing for it and eliminating it in 2018.
Dark Heart Nursery Founder Dan Grace told Cannabis Now that the research the nursery started in regards to HpLVd would typically be done by universities as a service to industry. “You look at UC Davis and they have a department called Foundation Plant Services,” he said. “The work that we’ve done here with cannabis, they would normally do for grapes, sweet potatoes, almonds and stuff like that. It’s almost always a government service to the industry.”
Dark Heart Nursery identifies pot pathogen BTW, Dark Heart was not the first to ID this in Cannabis
https://www.dailydemocrat.com/2019/0...-pot-pathogen/
OAKLAND — Dark Heart Nursery has announced that it is the first organization to positively identify hop latent viroid as the cause of “dudding” in cannabis.
Since 2018, Dark Heart, which has growing operations in Yolo County, has also been successfully testing for and eliminating HpLVd through a patent-pending clean plant process.
On the heels of this research, the company has also announced that project lead Dr. Jeremy Warren has officially joined DHN as director of Plant Health.
“The positive identification of the HpLVd pathogen and our patent-pending clean plant process to test for and eliminate it represent a significant advance towards keeping cannabis crops healthy and supporting long-term business growth for cultivators,” said Dan Grace, founder and president of Dark Heart Nursery. “With Dr. Warren at the helm, we are incredibly excited to now offer diagnostic and curative services for HpLVd to licensed cannabis businesses in California, as well as continue our research in identifying and eradicating additional cannabis-infecting pathogens.”
“Dudding” is a colloquial name for a variety of symptoms, which include loss of vigor, stunting, reduction in yield, reduction in potency and changes in morphology. The syndrome was codified in 2017 by Dr. Rick Crum who first coined the phrase “Putative Cannabis Infectious Agent” to describe it.
In 2015, Dr. Crum reported that as many as 35 percent of observed plants showed PCIA symptoms.
In 2017, Dark Heart Nursery began working with Dr. Warren to determine the cause of PCIA. Symptomatic and asymptomatic plants were collected, and next generation RNA sequencing was performed to determine a probable cause of the disease.
After analysis of the results in November 2017, it was determined that Hop latent viroid (HpLVd) was the most likely candidate pathogen. A genetic test was then developed to aid in differentiating healthy plants from infected plants.
In 2014, Dark Heart established the cannabis industry’s first tissue culture laboratory. Among other areas of research, this lab has focused on the development of clean plant protocols through which cannabis can be cured of pathogens and cataloged for later use.
Not Cannabis specific
Deep learning models for plant disease detection and diagnosis
Konstantinos P. Ferentinos
Computers and Electronics in Agriculture 145 (2018) 311–318
DOI: 10.1016/j.compag.2018.01.009
https://www.researchgate.net/publica..._and_diagnosis
In this paper, convolutional neural network models were developed to perform plant disease detection and diagnosis using simple leaves images of healthy and diseased plants, through deep learning methodologies. Training of the models was performed with the use of an open database of 87,848 images, containing 25 different plants in a set of 58 distinct classes of [plant, disease] combinations, including healthy plants. Several model architectures were trained, with the best performance reaching a 99.53% success rate in identifying the corresponding [plant, disease] combination (or healthy plant). The significantly high success rate makes the model a very useful advisory or early warning tool, and an approach that could be further expanded to support an integrated plant disease identification system to operate in real cultivation conditions
NOT CANNABIS SPECIFIC but the virus is found in Cannabis
Detection and molecular analysis of Hop latent virus and Hop latent viroid in hop samples from Poland
July 2014Journal fur Kulturpflanzen 66(7):248-254
DOI: 10.5073/JFK.2014.07.04
Angelika Ziegler, Magdalena Kawka, Marcin Przybys, Jl Schubert
Monitoring the occurrence of virus diseases in plants is important for the implementation of early control measures and prevention of further disease spread. In Poland, in 2004 a health programme for hop was started to eliminate viruses and viroids. In 2012/13, in vitro plants, samples from the IUNG-PIB experimental station and commercial hop gardens in Poland were tested for Hop latent virus (HpLV), and Hop latent and Hop stunt viroids (HpLVd and HpSVd). For virus testing, RT-PCR and ELISA methods were used. In order to detect hop viroids, RT-PCR was employed. The overall incidence of HpLV and hop viroids was lower than reported before the start of the programme. Cloning and sequencing revealed that the HpLV and the HpLVd from Polish sources are very similar to the type sequences and the Czech sources.
Developing Insect Pest Management Systems for Hemp in the United States: A Work in Progress
Whitney Cranshaw, Melissa Schreiner, Kadie Britt, Thomas P. Kuhar, John McPartland, and Jerome Grant
Journal of Integrated Pest Management, (2019)
doi: 10.1093/jipm/pmz023
Hemp (Cannabis sativa L.) is now being grown within the United States over a much broader geographic area and for different uses than during its last period of significant production that ended after World War II. Within the past 3 yr, a large number of arthropod species have been documented to feed on hemp in the United States. Among key pest species, corn earworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae), has demonstrated greatest potential for crop injury, being particularly damaging to flower buds. Hemp russet mite, Aculops cannibicola (Farkas), and cannabis aphid, Phorodon cannabis Passerini, are the two species observed most damaging among those that suck plant fluids. Eurasian hemp borer, Grapholita delineana Walker, is widely present east of the Rocky Mountains and appears to have potential to significantly damage both flower buds and developing seeds. Numerous species of caterpillars, grasshoppers, and beetles chew hemp foliage; the severity of these defoliation injuries appears to be minimal, but needs further study. Similarly, numerous seed feeding hemipterans, most notably stink bugs and Lygus bugs, are regularly found in the crop but injury potential remains unclear. Some preliminary efforts have been made to develop integrated pest management strategies for these insects, particularly for corn earworm. Future research can be expected to rapidly resolve many of the data gaps that presently restrict advancing pest management on the crop. However, a major confounding issue involves the use of pesticides on hemp. Federal agencies have not yet provided clear direction on this issue, and regulatory decisions have subsequently devolved to the states.
Differentiating Powdery Mildew from False Powdery Mildew
John McPartland, Karl Hillig
April 2008 Journal of Industrial Hemp 13(1):78-87
DOI: 10.1080/15377880801898758
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring color illustrations of signs and symptoms. The fungus Trichothecium roseum produces a white fuzz that covers branches, leaves, and flowering tops of hemp. These symptoms have been confused with true powdery mildew, caused by Sphaerotheca macularis. We illustrate the differences between disease caused by Trichothecium roseum (henceforth dubbed “false powdery mildew”) and disease caused by Sphaerotheca macularis.
While the resistance gene PM1 is an important discovery it is actually more important to eliminate any MLO susceptibility genes in a Cannabis variety, to have no PM. Breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
*Discovery and Genetic Mapping of PM1, a Powdery Mildew Resistance Gene in Cannabis sativa L.
Paul D. Mihalyov and Andrea R. Garfinkel
Front. Agron. 3:720215. (2021)
doi: 10.3389/fagro.2021.720215
https://www.frontiersin.org/articles...170000_ARTICLE
Powdery mildew is among the most common diseases of both hemp- and marijuana-type cultivated Cannabis sativa . Despite its prevalence, no documented studies have characterized sources of natural genetic resistance in this pathosystem. Here we provide evidence for the first resistance (R ) gene in C. sativa , represented by a single dominant locus that confers complete resistance to an isolate of the powdery mildew pathogen Golovinomyces ambrosiae , found in the Pacific Northwest of the United States. Linkage mapping with nearly 10,000 single nucleotide polymorphism (SNP) markers revealed that this R gene (designated PM1 ) is located on the distal end of the long arm of one of the largest chromosomes in the C. sativa genome. According to reference whole genome sequences and Sanger sequencing, the marker was tentatively placed in a cluster of R genes of the nucleotide-binding site (NBS) and leucine-rich repeat (LRR) protein type. PM1 ’s dominant behavior, qualitative penetrance, and a co-segregating qPCR marker to track its inheritance were confirmed in two separate genetic backgrounds totaling 185 recombinant F1 plants. The goal of this study is to provide a foundation for the discovery and characterization of additional sources of genetic resistance to pathogens that infect C. sativa .
Effect of Cannabis sativa L. root, leaf and inflorescence ethanol extracts on the chemotrophic response of entomopathogenic nematodes.
Žiga Laznik & Iztok Jože Košir & Katarina Košmelj & Jana Murovec & Anamarija Jagodi? & Stanislav Trdan & Darja Kocjan A?ko & Marko Flajšman
Plant and Soil. (2020).
doi:10.1007/s11104-020-04693-z
Aims Soils represent the natural habitat of entomopathogenic nematodes (EPNs). When moving in soil, EPNs are oriented to follow a chemical signal (chemotaxis). Cannabis sativa L. is known to secrete a very wide spectrum of secondary metabolites. Ethanol extracts (EE) of different C. sativa L. organs were used to study the effect on EPN chemotaxis. Methods The root, leaf and inflorescence EE of two hemp varieties and two medical cannabis breeding lines were used in laboratory chemotaxis assays with three EPN species (Steinernema carpocapsae, S. feltiae and Heterorhabditis bacteriophora) at 20 and 25 °C. The content of terpenes and cannabinoids in C. sativa L. inflorescences was measured as well. Results Overall, EPNs were most attracted or repelled by inflorescence extracts, followed by leaves and roots. The most abundant terpene in hemp inflorescences was trans caryophyllene (38.2% on average), the highest contents of total cannabidiol, total cannabigerol and total tetrahydrocannabinol were 9.65%, 0.89% and 0.62%, respectively. Conclusions The attraction effect of S. sativa L. EE is a highly interesting outcome and could lead to the development of attractant compounds in EPN biological control. Cannabinoids and terpenes may be responsible for pronounced effects on EPN chemotaxis.
Not Cannabis specific
Effect of UV-exposure on colony formation of Xanthomonas fragariae in vitro
G.J.T. Kessel & M.T. Schilder
https://cleanlight.nl/wp-content/upl...nas-report.pdf
Not Cannabis Specific
Effect of UV - exposure on germination of sporangia of Phytophthora infestans
G.J.T. Kessel & M.G. Förch
https://cleanlight.nl/wp-content/upl...ytophthora.pdf
The oomycete Phytophthora infestans, the cause of late blight in potato and tomato, is considered one of the most important pathogens of potatoes worldwide (Hooker 1981). P. infestans affects foliage and stems, reducing the photosynthetic capacity of the crop and therefore leading to yield reduction. In addition, it affects tubers which reduces both, yield quantity and quality. In the past, crop losses due to late blight have been estimated to account for 10 to 15 percent of the total global annual potato production (Anonymous, 1996). The economic value of the crop lost, plus the cost of crop protection amount to US $ three billion annually (Duncan, 1999). In the Netherlands, the cost of crop protection amounts to
approximately 40 million euro annually on a total of 160 -180 thousand hectares with an average yield of 45 tonnes fresh weight per hectare.
The life cycle of P. infestans can be separated into an asexual cycle and a sexual cycle. The asexual cycle is the driving force behind rapid polycyclic epidemics that can be observed in potato crops during the growing season. Numerous sporangia are produced on infected leaflets and stems. Sporangia are released into the atmosphere under dry conditions or they can be washed into the ridge by rain. When released into the atmosphere sporangia may cause new foliar infections in the same crop or neighbouring crops. When washed into the soil, sporangia may cause tuber infections. In both cases, the ambient temperature determines whether the sporangium germinates directly (optimum at ±23°C) or indirectly (optimum at ±12°C). Direct germination results in formation of a germ tube. Indirect germination results in formation of motile zoospores. When zoospores loose their flagellae, they become cystospores which germinate and infect through a germ tube
Effects of cold plasma, gamma and e-beam irradiations on reduction of fungal colony forming unit levels in medical cannabis inflorescences
Shachar Jerushalmi, Marcel Maymon, Aviv Dombrovsky and Stanley Freeman
Journal of Cannabis Research (2020) 2:12
doi: 10.1186/s42238-020-00020-6
Background: The use of medical cannabis (MC) in the medical field has been expanding over the last decade, as more therapeutic beneficial properties of MC are discovered, ranging from general analgesics to anti-inflammatory and anti-bacterial treatments. Together with the intensified utilization of MC, concerns regarding the safety of usage, especially in immunocompromised patients, have arisen. Similar to other plants, MC may be infected by fungal plant pathogens (molds) that sporulate in the tissues while other fungal spores (nonpathogenic) may be present at high concentrations in MC inflorescences, causing a health hazard when inhaled. Since MC is not grown under sterile conditions, it is crucial to evaluate current available methods for reduction of molds in inflorescences that will not damage the active compounds. Three different sterilization methods of inflorescences were examined in this research; gamma irradiation, beta irradiation (e-beam) and cold plasma to determine their efficacy in reduction of fungal colony forming units (CFUs) in vivo.
Methods: The examined methods were evaluated for decontamination of both uninoculated and artificially inoculated Botrytis cinerea MC inflorescences, by assessing total yeast and mold (TYM) CFU levels per g plant tissue. In addition, e-beam treatment was also tested on naturally infected commercial MC inflorescences.
Results: All tested methods significantly reduced TYM CFUs at the tested dosages. Gamma irradiation reduced CFU levels by approximately 6- and 4.5-log fold, in uninoculated and artificially inoculated B. cinerea MC inflorescences, respectively. The effective dosage for elimination of 50% (ED50)TYM CFU of uninoculated MC inflorescence treated with e-beam was calculated as 3.6 KGy. In naturally infected commercial MC inflorescences, e-beam treatments reduced TYM CFU levels by approximately 5-log-fold. A 10 min exposure to cold plasma treatment resulted in 5- log-fold reduction in TYM CFU levels in both uninoculated and artificially inoculated B. cinerea MC inflorescences.
Conclusions: Although gamma irradiation was very effective in reducing TYM CFU levels, it is the most expensive and complicated method for MC sterilization. Both e-beam and cold plasma treatments have greater potential since they are cheaper and simpler to apply, and are equally effective for MC sterilization.
Not cannabis specific
ELIMINATION OF HOP LATENT VIROID FROM HOP PLANTS BY COLD TREATMENT AND MERISTEM TIP CULTURE
M. Grudzińska, E. Solarska, A. Czubacka, M. Przybyś and A. Fajbuś
http://www.up.poznan.pl/~ptfit1/pdf/...PP40_21-30.pdf
Cold treatment and meristem tip culture were used for elimination of Hop latent viroid from four cultivars of hop (Humulus lupulus). Efficiency of the method was compared for hop cultivars,cold treatments of tested plants and time of meristems excision. HLVd was successfully eliminated from infected plants after one month of cold treatment. Good results were also obtained after cooling tested plants during winter. Excising the meristems as soon as possible after ending of plant cooling was an important factor in HLVd elimination. The effectiveness of viroid elimination depended also on hop cultivar. The use of a very sensitive diagnostic method RT-PCR to confirm complete viroid elimination from infected plants resulted in obtaining a population of HLVd-free hop plants,which remained healthy also after dormancy period.
Not Cannabis Specific
Elimination of Hop Stunt Viroid (HSVd) from Infected Peach and Pear Plants Using Cold Therapy and Chemotherapy
Australian Journal of Basic and Applied Sciences, 4(1): 54-60, 2010
Kh.A. El-Dougdoug, Osman M.E., Abdelkader Hayam S., Dawoud Rehab, A.,and Elbaz Reham M.
https://www.researchgate.net/profile...a97c000000.pdf
Hop stunt viroid (HSVd) was detected in several pear and peach trees collected during summer season by RT-PCR and molecular hybridization assays. Hop stunt viroid disease was very severe in summer; however, the multiplication of viroid decreases drastically in winter. In this study, the shoots cut from Prunus persicae cv. Florida prince and Pierre corneille cv. Balady infected plants treated by cold therapy, thermotherapy and/or chemotherapy was used successfully to eliminate Hop stunt viroid. Results demonstrated that application of 10 to 20 mg/L Virazole. followed by cold
therapy for 30 days at 4ÅãC in vitro gave a survival rate of 63 and 75% for pear and peach respectively. The presence of viroid in recovered plants was evaluated by tissue print hybridization technique. In vitro cold therapy combined with chemotherapy using shoot tip culture eliminates HSVd from infected peach and pear trees and reduces the risk of introducing this pathogen to Egypt.
Elimination of hop latent viroid upon developmental activation of pollen nucleases
Jaroslav Matousek , Lidmila Orctová, Josef Skopek, Karel Pesina, Gerhard Steger
Biol Chem. 2008 Jul.
DOI: 10.1515/BC.2008.096
https://www.academia.edu/19146337/El...op_latent_viro id_upon_developmental_activati on_of_pollen_nucleases
Hop latent viroid (HLVd) is not transmissible through hop generative tissues and seeds. Here we describe the process of HLVd elimination during development of hop pollen. HLVd propagates in uninucleate hop pollen, but is eliminated at stages following first pollen mitosis during pollen vacuolization and maturation. Only traces of HLVd were detected by RT-PCR in mature pollen after anthesis and no viroid was detectable in in vitro germinating pollen, suggesting complete degradation of circular and linear HLVd forms. The majority of the degraded HLVd RNA in immature pollen included discrete products in the range of 230-100 nucleotides and therefore did not correspond to siRNAs. HLVd eradication from pollen correlated with developmental expression of a pollen nuclease and specific RNAses. Activity of the pollen nuclease HBN1 was maximal during the vacuolization step and decreased in mature pollen. Total RNAse activity increased continuously up to the final steps of pollen maturation. HBN1 mRNA, which is abundant at the uninucleate microspore stage, encodes a protein of 300 amino acids (34.1 kDa, isoeletric point 5.1). Sequence comparisons revealed that HBN1 is a homolog of S1-like bifunctional plant endonucleases. The developmentally activated HBN1 and pollen ribonucleases could participate in the mechanism of HLVd recognition and degradation.
Emerging diseases of Cannabis sativa and sustainable management
Zamir K Punja
Pest Management Science (2021)
DOI: 10.1002/ps.6307
No PDF of this
Cultivation of cannabis plants (Cannabis sativa L., marijuana) has taken place worldwide for centuries. In Canada, legalization of cannabis in October 2018 for the medicinal and recreational markets has spurned interest in large‐scale growing. This increased production has seen a rise in the incidence and severity of plant pathogens, causing a range of previously unreported diseases. The objective of this review is to highlight the important diseases currently affecting the cannabis and hemp industries in North America and to discuss various mitigation strategies. Progress in molecular diagnostics for pathogen identification and determining inoculum sources and methods of pathogen spread have provided useful insights. Sustainable disease management approaches include establishing clean planting stock, modifying environmental conditions to reduce pathogen development, implementing sanitation measures, and applying fungal and bacterial biological control agents. Fungicides are not currently registered for use and hence there are no published data on their efficacy. The greatest challenge remains in reducing microbial loads (colony‐forming units) on harvested inflorescences (buds). Contaminating microbes may be introduced during the cultivation and post‐harvest phases, or constitute resident endophytes. Failure to achieve a minimum threshold of microbes deemed to be safe for utilization of cannabis products can arise from organic cultivation methods or application of beneficial biocontrol agents. The current regulatory process for approval of cannabis products presents a challenge to producers utilizing biological control agents for disease management.
Endophytic fungi harbored in Cannabis sativa L.: diversity and potential as biocontrol agents against host plant-specific phytopathogens
Parijat Kusari & Souvik Kusari & Michael Spiteller & Oliver Kayser
Fungal Diversity (2013) 60:137–151
DOI 10.1007/s13225-012-0216-3
The objective of the present work was isolation, phylogenetic characterization, and assessment of biocontrol potential of endophytic fungi harbored in various tissues (leaves, twigs, and apical and lateral buds) of the medicinal plant, Cannabis sativa L. A total of 30 different fungal endophytes were isolated from all the plant tissues which were authenticated by molecular identification based on rDNA ITS sequence analysis (ITS1, 5.8S and ITS2 regions). The Menhinick’s index revealed that the buds were immensely rich in fungal species, and Camargo’s index showed the highest tissue-specific fungal dominance for the twigs. The most dominant species was Penicillium copticola that could be isolated from the twigs, leaves, and apical and lateral buds. A detailed calculation of Fisher’s log series index, Shannon diversity index, Simpson’s index, Simpson’s diversity index, and Margalef’s richness revealed moderate overall biodiversity of C. sativa endophytes distributed among its tissues. The fungal endophytes were challenged by two host phytopathogens, Botrytis cinerea and Trichothecium roseum, devising a dual culture antagonistic assay on five different media. We observed 11 distinct types of pathogen inhibition encompassing a variable degree of antagonism on changing the media. This revealed the potential chemodiversity of the isolated fungal endophytes not only as promising resources of biocontrol agents against the known and emerging phytopathogens of Cannabis plants, but also as sustainable resources of biologically active and defensive secondary metabolites.
Endophytic microflora harbored in Cannabis sativa
Parijat Kusari, Souvik Kusari, Michael Spiteller, Oliver Kayser
Technische Universitat Dortmund
Cannabis sativa is an annual herbaceous plant of the Cannabaceae family from central Asia. Cannabinoids are one of the major secondary metabolites of this plant, which are known to have important therapeutic benefits like analgesic, anti-inflammatory, neuro-protective, appetite-stimulant and many more. Endophytic microorganisms (endophytes) still remain an unexplored group of very promising organism with diverse potential for exploitation, that are capable of producing bioactive secondary metabolites, sometimes even those natural products considered exclusive to their host plants. Thus, these microorganisms are important not only from molecular and biochemical standpoint but also from the ecological perspectives.
Find Pdf
(In Turkish)
ENDÜSTR?YEL KENEV?RDE HASTALIK, ZARARLI ve YABANCI OT MÜCADELES?/PEST, DISEASE AND WEED CONTROL IN INDUSTRIAL HEMP
Huseyin Onen
https://www.researchgate.net/publica...NDUSTRIAL_HEMP
Bütün kültür bitkilerinde oldu?u gibi kenevir tar?m?nda da bitki koruma etmenleri üretimin en önemli s?n?rlay?c? faktörler aras?nda yer almaktad?r. Ancak ülkemizde kenevir üretimine yakla??k 20 y?ld?r ara verilmesi kenevir üretim sürecinde uygulanan kültürel i?lemlere ili?kin bilgi birikiminde de erozyona neden olmu?tur. Kenevir üretiminin yayg?nla?t?r?lmas?n?n gündemde oldu?u dikkate al?nd???nda; üretim sürecinde meydana gelen bo?luk da göz önünde bulundurularak, bitki koruma sorunlar? ve bunlar?n çözümü konusunda bilgi eksikli?inin giderilmesini zorunluluk haline getirmektedir. Bu dü?ünceden yola ç?k?larak, “kenevir tar?m? için bitki koruma el kitab?” mahiyetinde ki mevcut çal??mayla; öncelikle kenevirde görülen yabanc? ot türleri ve bunlar?n idaresinde izlenecek prosedürlerin ele al?nmas? hedeflenmi?tir. Ancak konu bütünlü?ünün sa?lanmas? amac?yla kenevir bitkisinin genel özelliklerine de?inilmi?, dünya genelinde kenevirde sorun olu?turan ve ekim alanlar?n?n geni?lemesiyle birlikte ülkemizde de kar??la?abilece?imiz muhtemel hastal?k etmenleri ile zararl?lar ve bunlar?n kontrolü konular? da ele al?nm??t?r. Geni? bir derleme mahiyetindeki bu el kitab?n?n ba?ta üreticiler olmak üzere konuyla alakal? teknik personel ve ara?t?r?c?lara faydal? olmas? en büyük sevinç kayna??m olacakt?r. Di?er taraftan herboloji konusunda Türkçe kaynak yetersizli?i dikkate al?nd???nda; haz?rlanan bu el kitab?n?n gelece?in Ziraat Mühendisi adaylar? Ziraat Fakültelerinin çok de?erli ö?rencilerine yard?mc? kaynak olarak i? görebilmesi de amaçlanm??t?r. Daha geni? kitlelere ula??labilmesi için el kitab? elektronik olarak haz?rlanm?? olup ücretlidir. Ücreti; en az bir kez okumak ve varsa öneri/ele?tirilerin yazara iletilmesidir. Bu durum mevcut kayna??n ihtiyaçlar do?rultusunda geni?letilmesi için önem ta??maktad?r. Faydal? olmas? temennisi ile…
Industrial hemp production areas in Turkey have been recently intended to increase, therefore intensive research and development activities are being conducted to achieve the goal. Introducing the hemp, which was removed from the agricultural crop rotation many years ago, into the crop rotation will bring new crop-pest interactions to the agenda. Therefore detailed studies on plant protection (pests, diseases and weeds management) will be needed for a successful industrial hemp production. In this context, this handbook (in Turkish) was compiled from a detailed literature survey and observations on hemp cultivation areas in our country. The handbook is aimed to inform the producers about plant protection (pest, disease and weed management) in industrial hemp production, with a special emphasis on weeds and their management. The study also intended to provide scientific information to researches on integrated pest/weed management in industrial hemp production, and education material for students in agricultural faculties of the country. In the handbook; I) Pests, pathogens and weeds constitute an inseparable complex in the agro-ecosystems. Therefore all problematic agents (diseases and pests) in hemp production areas along with weeds have been discussed in general. II) Problems arising from pests and pathogens in hemp production areas are addressed in broad terms, while the problems caused by the weeds have been discussed in a wider context. III) Weeds causing problems in the hemp fields worldwide have been listed, parasitic weed (dodder and broomrape) species have been determined, and the noxious weeds in hemp production have been documented based on observations in different parts of the country. IV) Strategies that can be used under the “Integrated Pest Management (IPM)” context in industrial hemp fields have been summarized based on the results obtained in different regions of the world. V) The results of scientific studies revealed that the plant is extremely competitive as a consequence of allopathic effect of hemp, and the plant can easily suppress the weeds with cultural measures such as proper site selection, using competitive varieties, early planting, adjusting the plant density, and appropriate fertilization and irrigation etc. Nevertheless, the weed problems that may arise can be easily overcome by soil cultivation. In addition, the plant has been determined also as tolerant to pathogens/pests. Therefore, pesticide use may not be needed in industrial hemp production areas. VI) The volunteer hemps which have similar characteristics with the problematic weeds in agro ecosystems can arise as a weed especially in crops such as cereals and sunflower. The literature review revealed that monitoring the changes in weed population depending on ecological conditions in agricultural areas is needed, and studies on comparison of different hemp varieties, especially local varieties, for weed competitiveness, and regional critical period studies considering the ecological conditions and possible changes in weed populations will be beneficial. In addition, with regard to weed control, studies depending on the purpose of production (fiber and seed) should be carried out to determine the most appropriate sowing time, sowing depth and sowing rate, and the number and timing of the mechanical weed control (hoeing) should be determined. Moreover, studies such as screening pesticides (including herbicides) candidates are needed to determine the potential pesticides that can be used in hemp production. The review/handbook summarizes the current information and status that may be useful to contribute to the establishment of pest/weed management programs in industrial hemp production in Turkey. Sufficient information on cultural measure (soil tillage, sowing, selection of varieties, fertilization, etc.) which may be needed during the hemp production and fiber processing technology, etc. is available in the literature. However, studies on plant protection in general and weed management in particular are very scarce. This reveals that the information presented in the review may need to be revised in the near future. Since there are important data gaps in the literature regarding on weed and pest management, the data and experiences gained in time can allow to have different perspectives.
Epidemiology of the Hemp Borer, Grapholita delineana Walker (Lepidoptera: Oleuthreutidae), a Pest of Cannabis sativa L.
John M. McPartland
Journal of Industrial Hemp 2002 7:1, 25-42
DOI: 10.1300/J237v07n01_04
The hemp borer, Grapholita delineana, is newly described from feral hemp in Vermont, USA. It may pose a serious pest should hemp cultivation resume in the USA. A similar situation occurred in the 1960s, when G. delineana suddenly became a serious pest in southeastern Europe. Evidence suggests the pest was imported from its native range via infested hemp seed. Larvae of G. delineana bore into stalks and destroy fiber, or they infest flowering tops and destroy seed. The larvae and adults are described, along with their life history, geographic range, and host range. Careful phytosanitary measures can prevent the spread of G. delineana into quarantine areas, such as western Europe, Canada, and the entire southern hemisphere. Breeding hemp plants for resistance to G. delineana may prevent future epidemics. Vermont feral hemp appears to be more resistant to G. delineana than feral hemp growing in the Midwestern USA; the Vermont germplasm may have descended from plants imported in the 1830s, called “Smyrna” hemp, a western European landrace devoid of Chinese ancestry. Biological and chemical controls of G. delineana are described.
Endophytes of industrial hemp (Cannabis sativa L.) cultivars: Identification of culturable bacteria and fungi in leaves, petioles, and seeds
Maryanne Scott, Mamta Rani, Mamta Rani, Jamil Samsatly, Suha Jabaji
June 2018 Canadian Journal of Microbiology 64(10):1-17
DOI: 10.1139/cjm-2018-0108
Plant endophytes are a group of microorganisms that reside asymptomatically within the healthy living tissue. The diversity and molecular and biochemical characterization of industrial hemp-associated endophytes have not been previously studied. This study explored the abundance and diversity of culturable endophytes residing in petioles, leaves, and seeds of three industrial hemp cultivars, and examined their biochemical attributes and antifungal potential. A total of 134 bacterial and 53 fungal strains were isolated from cultivars Anka, CRS-1, and Yvonne. The number of bacterial isolates was similarly distributed among the cultivars, with the majority recovered from petiole tissue. Most fungal strains originated from leaf tissue of cultivar Anka. Molecular and phylogenetic analyses grouped the endophytes into 18 bacterial and 13 fungal taxa, respectively. The most abundant bacterial genera were Pseudomonas, Pantoea, and Bacillus, and the fungal genera were Aureobasidium, Alternaria, and Cochliobolus. The presence of siderophores, cellulase production, and phosphorus solubilization were the main biochemical traits. In proof-of-concept experiments, re-inoculation of tomato roots with some endophytes confirmed their migration to aerial tissues of the plant. Taken together, this study demonstrates that industrial hemp harbours a diversity of microbial endophytes, some of which could be used in growth promotion and (or) in biological control designed experiments.
Endophytic fungi harbored in Cannabis sativa L.: diversity and potential as biocontrol agents against host plant-specific phytopathogens
Parijat Kusari & Souvik Kusari & Michael Spiteller & Oliver Kayser
Fungal Diversity (2013) 60:137–151
DOI 10.1007/s13225-012-0216-3
The objective of the present work was isolation, phylogenetic characterization, and assessment of biocontrol potential of endophytic fungi harbored in various tissues (leaves, twigs, and apical and lateral buds) of the medicinal plant, Cannabis sativa L. A total of 30 different fungal endophytes were isolated from all the plant tissues which were authenticated by molecular identification based on rDNA ITS sequence analysis (ITS1, 5.8S and ITS2 regions). The Menhinick’s index revealed that the buds were immensely rich in fungal species, and Camargo’s index showed the highest tissue-specific fungal dominance for the twigs. The most dominant species was Penicillium copticola that could be isolated from the twigs, leaves, and apical and lateral buds. A detailed calculation of Fisher’s log series index, Shannon diversity index, Simpson’s index, Simpson’s diversity index, and Margalef’s richness revealed moderate overall biodiversity of C. sativa endophytes distributed among its tissues. The fungal endophytes were challenged by two host phytopathogens, Botrytis cinerea and Trichothecium roseum, devising a dual culture antagonistic assay on five different media. We observed 11 distinct types of pathogen inhibition encompassing a variable degree of antagonism (%) on changing the media. This revealed the potential chemodiversity of the isolated fungal endophytes not only as promising resources of biocontrol agents against the known and emerging phytopathogens of Cannabis plants, but also as sustainable resources of biologically active and defensive secondary metabolites.
Not Cannabis specific
Escherichia coli Cells Exposed to Lethal Doses of Electron Beam Irradiation Retain Their Ability to Propagate Bacteriophages and Are Metabolically Active
Front. Microbiol., 10 September 2018
DOI: 10.3389/fmicb.2018.02138
https://www.frontiersin.org/articles...EJ8bOqXDYTcT-0
Reports in the literature suggest that bacteria exposed to lethal doses of ionizing radiation, i.e., electron beams, are unable to replicate yet they remain metabolically active. To investigate this phenomenon further, we electron beam irradiated Escherichia coli cells to a lethal dose and measured their membrane integrity, metabolic activity, ATP levels and overall cellular functionality via bacteriophage infection. We also visualized the DNA double-strand breaks in the cells. We used non-irradiated (live) and heatkilled cells as positive and negative controls, respectively. Our results show that the membrane integrity of E. coli cells is maintained and that the cells remain metabolically active up to 9 days post-irradiation when stored at 4_ C. The ATP levels in lethally irradiated cells are similar to non-irradiated control cells. We also visualized extensive DNA damage within the cells and confirmed their cellular functionality based on their ability to propagate bacteriophages for up to 9 days post-irradiation. Overall, our findings indicate that lethally irradiated E. coli cells resemble live non-irradiated cells more closely than heat-killed (dead) cells.
Not Cannabis specific
Eukaryotic Translation Initiation Factors Shape RNA Viruses Resistance in Plants
Jannat Shopan, Xiaolong Lv, Zhongyuan Hu, Mingfang Zhang, Jinghua Yang
Horticultural Plant Journal (2020)
DOI: 10.1016/j.hpj.2020.03.001
Viruses are representative of a global threat to agricultural production. Genetic resistance is the preferred strategy for the control of viral infection and against loss of crop yield. Viral protein synthesis requires host cellular factors for translating their viral RNAs, and for regulating their replication and cell to cell systemic movement. Therefore, the viruses are dependent on cellular translation factors. Mutations in the gene encoding eIF4E and eIF4G or their isoforms, eIFiso4E, eIFiso4G and eIF2B? have been mapped as a source of plant potyvirus while other genus of plant virus recessive resistance genes in many species are originated from these loci. Some of other plant translation factors, such as eIF3, eIF4A-like helicases, eEF1A and eEF1B, which are required in interacting with viral RNAs and regulating various aspects of the infection cycle, have also been identified. Here, we summarize the mechanisms utilized by RNA viruses of eukaryotic plants and the essential roles of eIFs in virus infection. Moreover, we discuss the potential of eIFs as a target gene in the development of genetic resistance to viruses for crop improvement. This review highlighted newly revealed examples of abnormal translational strategies and provided insights into natural host resistance mechanisms that have been linked to 3’ cap-independent translational enhancer activity.
Evaluating herbicide tolerance of industrial hemp
(Cannabis sativa L.)
January 2020
Crop Science*60(1):419-427
DOI: 10.1002/csc2.20055
Michael L. Flessner Jabari Bryd, Kevin W. Bamber, John H. Fike
Industrial hemp (Cannabis sativa L.) has a wide array of end uses which, when coupled with regulatory reductions in the United States, has spurred renewed interest in its production. Best management practices, including weed control, need to be evaluated. Since little is known about herbicide tolerance of hemp, studies were conducted to identify suitable options for grain or dual?purpose (fiber and grain) production. Greenhouse experiments with pre?emergence and postemergence herbicides were conducted to identify herbicide choices for subsequent field trials. In field studies, S?metolachlor was the safest pre?emergence herbicide, resulting in 0 and ? 15% injury in 2017 and 2018, respectively, and a hemp stand count that was 97% of the nontreated check (pooled across years). All other pre?emergence herbicides tested in the field resulted in ? 25% visible injury in at least one of the years and ? 24% stand reduction relative to the nontreated check (pooled across years). However, no grain yield differences were observed due to pre?emergence herbicides relative to the nontreated check. Postemergence herbicides sethoxydim, quizalofop, bromoxynil, and clopyralid caused < 20% injury across rating timings and years and had similar grain yield as the nontreated check (588 kg ha?1). Our results indicate that S?metolachlor applied pre?emergence or sethoxydim, quizalofop, bromoxynil, and clopyralid applied postemergence are suitable for hemp production, but some of these treatments caused transient visible injury. Future research should be conducted to corroborate results across cultivars, soil types (for pre?emergence herbicides), and environments.
Evaluating the Microbiome of Hemp
Samuel E. Barnett,1 Ali R. Cala,2 Julie L. Hansen,3 Jamie Crawford,3 Donald R. Viands,3 Lawrence B. Smart,4 Christine D. Smart,2,† and Daniel H. Buckley
Phytobiomes Journal • 2020 • 4:351-363
Doi: 10.1094/PBIOMES-06-20-0046-R
Plant microbiomes contribute to plant fitness and crop yields through a variety of mechanisms. Determining variability in microbiome composition among individuals of a species, and identifying core microbiome membership, are essential first steps for exploring host–microbe interactions. Members of a core microbiome are microorganisms that are tightly associated with and are found widespread across individuals of a plant genotype or species. Hemp (Cannabis sativa L.) is an economically important crop that has gained a resurgence following its removal from the list of controlled substances by the U.S. government. Despite renewed interest in this crop, the microbiome of hemp has not been well studied. We analyzed the bacterial and fungal communities associated with four plant compartments (rhizosphere, root tissue, leaf surface, and flowers) of C. sativa ‘Anka’ across six fields in the Finger Lakes region of New York, United States. We found that both bacterial and fungal community composition varied significantly among plant compartments. Rhizosphere communities were largely similar to the bulk soil communities but root tissue, leaf, and flower communities had distinct compositions. We identified candidate core microbiome members of each plant compartment (bacterial core taxa: root tissue [n = 6], leaves [n = 11], and flowers [n = 7]; fungal core taxa: rhizosphere [n = 1], leaves [n = 14], and flowers [n = 2]). Many of these candidate core microbiome members were related to organisms previously associated with plant growth promotion or pathogen resistance in various plants. The core microbiome identified in this study can be further investigated to improve cultivation of this important crop
Evaluation of Biological Insecticides to Control Corn Earworm in Hemp, 2019
Helene Doughty, Kadie Britt, Thomas P Kuhar
Arthropod Management Tests 45(1) January 2020
DOI: 10.1093/amt/tsaa081 https://www.researchgate.net/publica...m_in_Hemp_2019
The objective of this experiment was to assess the efficacy of several biological insecticide products for control of corn earworm (CEW) on grain hemp in Virginia. A field experiment was conducted on planting of ‘Felina 32’ hemp direct seeded with a grain drill at 30 lb. seed per acre on 24 Jun 2019 at the Virginia Tech Eastern Shore Agricultural Research and Extension Center in Painter, VA. The experiment had six treatments: Gemstar (Helicoverpa zea nuclear polyhedrosis virus [HzNPV]), Javelin (Bacillus thuringiensis var. kurstaki), BoteGHA (Beauveria bassiana strain GHA), Entrust (Spinosad), DiPel (Bacillus thuringiensis var. kurstaki), and an untreated check arranged in an RCBD with four replicates. Individual plots were 3 Å~ 10 ft (0.91 Å~ 3.05 m). Hemp plants were sprayed with insecticides in the field using a single-nozzle boom equipped with D3 spray tips powered by a CO2 backpack sprayer at 40 psi. For each treatment, 40.6 fl. oz (1200 ml) was applied to all four replicates, which equates to 58 gallons per acre. All treatments were applied twice with a 7-d interval, except for Gemstar, which was applied three times at 3-d intervals. Treatments were applied on 13 Aug (all treatments), 16 Aug (Gemstar only), 19 Aug (Gemstar only), and 20 Aug (all treatments except Gemstar). On 12 (pre-count), 20, 27 Aug, and 3 Sep, the number of lepidopteran larvae were recorded per inspection of 10 randomly selected plants per plot. On 3 Sep, 10 plants were examined for feeding damage by CEW according to the following rating scale: 0 = no feeding, 1 = some browning/ damage, 2 = advanced browning and feeding damage/holes in seeds, 3 = advanced feeding damage/clipped bud (Table 1). All data were analyzed using ANOVA procedures. Means were separated using Fisher’s LSD at the 0.05 level of significance. CEW was the dominant lepidopteran species observed with an average of 4.2 larvae per 10 plants on 12 Aug (Table 1). Most CEW larvae observed were either second or third instar. Other recorded larvae included yellowstriped armyworm (YSAW) and SMC, but these represented <5% of the total population of lepidopteran larvae. There was a significant treatment effect on CEW counts on 20 Aug with only Entrust resulting in significantly fewer CEW than the untreated check. Although plots treated with Gemstar did not have significantly lower CEW counts, approximately 3–5% of the larvae were diseased with characteristic virus symptoms on 20 and 27 Aug compared with virtually no diseased larvae in the other plots. There was also a significant treatment effect on CEW damage rating, with Entrust resulting in significantly less damage than the untreated check and all other treatments. This is also reflected in the larval count data.
Not Cannabis Specific
Examinations of Fusarium sambucinumon Humulus lupulus and Co-infection with Hop stunt viroid in Commercial Hop Fields
Natasha R. Cerruti THESIS
https://ir.library.oregonstate.edu/c...ions/vq27zs95m
After an unusually high incidence of Fusarium canker was observed in commercial hop fields of the Pacific Northwest, field surveys were conducted and revealed that canker incidence ranged from 20 to 60% of bines sampled in six commercial fields, as well as wide-spread Hop stunt viroid infection in these six fields. A variety of inoculation techniques and incubation conditions were evaluated in laboratory and greenhouse studies to determine whether Fusarium sambucinum incites girdling symptoms on hop bines, which is characteristic of later stage Fusarium canker infection in commercial hop fields. Koch?s postulates were fulfilled, confirming that F. sambucinum incites Fusarium canker and produces girdling, killing the bine. Colonization of detached hop stems with green fluorescent protein-labeled F. sambucinum or F. verticillioides were observed microscopically, but F. sambucinum colonized more aggressively and to a greater extent. Investigation into the effect of relative humidity on colonization of hop stems demonstrated that relative humidities greater than 88% are required for F. sambucinum to colonize green hop stems. Hilling of commercial hop plants was explored as a management strategy to ameliorate canker symptoms or improve yields in commercial fields with wide-spread Hop stunt viroid infection and results indicate that hilling can improve cone yields in commercial hop plantings co-infected with HpSVd and F. sambucinum.
Exploiting Beneficial Pseudomonas spp. for Cannabis Production
Carole Balthazar, David L. Joly and Martin Filion Front. Microbiol. 12:833172.
doi: 10.3389/fmicb.2021.833172 https://www.researchgate.net/publica...ion/references
Among the oldest domesticated crops, cannabis plants (Cannabis sativa L., marijuana and hemp) have been used to produce food, fiber, and drugs for thousands of years. With the ongoing legalization of cannabis in several jurisdictions worldwide, a new high value market is emerging for the supply of marijuana and hemp products. This creates unprecedented challenges to achieve better yields and environmental sustainability, while lowering production costs. In this review, we discuss the opportunities and challenges pertaining to the use of beneficial Pseudomonas spp. bacteria as crop
inoculants to improve productivity. The prevalence and diversity of naturally occurring Pseudomonas strains within the cannabis microbiome is overviewed, followed by their potential mechanisms involved in plant growth promotion and tolerance to abiotic and biotic stresses. Emphasis is placed on specific aspects relevant for hemp and marijuana crops in various production systems. Finally, factors likely to influence inoculant efficacy are provided, along with strategies to identify promising strains, overcome commercialization bottlenecks, and design adapted formulations. This work
aims at supporting the development of the cannabis industry in a sustainable way, by exploiting the many beneficial attributes of Pseudomonas spp.
Expression of Putative Defense Responses in Cannabis Primed by Pseudomonas and/or Bacillus Strains and Infected by Botrytis cinerea
Carole Balthazar, Gabrielle Cantin, Amy Novinscak, David L. Joly and Martin Filion
Front. Plant Sci. 11:572112. 2020
doi: 10.3389/fpls.2020.572112
https://www.frontiersin.org/articles...20.572112/full
Cannabis (Cannabis sativa L.) offers many industrial, agricultural, and medicinal applications, but is commonly threatened by the gray mold disease caused by the fungus Botrytis cinerea. With few effective control measures currently available, the use of beneficial rhizobacteria represents a promising biocontrol avenue for cannabis. To counter disease development, plants rely on a complex network of inducible defense pathways, allowing them to respond locally and systemically to pathogens attacks. In this study, we present the first attempt to control gray mold in cannabis using beneficial rhizobacteria, and the first investigation of cannabis defense responses at the molecular level. Four promising Pseudomonas (LBUM223 and WCS417r) and Bacillus strains (LBUM279 and LBUM979) were applied as single or combined root treatments to cannabis seedlings, which were subsequently infected by B. cinerea. Symptoms were recorded and the expression of eight putative defense genes was monitored in leaves by reverse transcription quantitative polymerase chain reaction. The rhizobacteria did not significantly control gray mold and all infected leaves were necrotic after a week, regardless of the treatment. Similarly, no systemic activation of putative cannabis defense genes was reported, neither triggered by the pathogen nor by the rhizobacteria. However, this work identified five putative defense genes (ERF1, HEL, PAL, PR1, and PR2) that were strongly and sustainably induced locally at B. cinerea’s infection sites, as well as two stably expressed reference genes (TIP41 and APT1) in cannabis. These markers will be useful in future researches exploring cannabis defense pathways
*First Insights Into the Virus and Viroid Communities in Hemp (Cannabis sativa)
Judith Chiginsky, Kaitlyn Langemeier, Jacob MacWilliams, Tessa Albrecht, Whitney Cranshaw, Ana Cristina Fulladolsa, Marylee Kapuscinski, Mark Stenglein and Punya Nachappa
Front. Agron. 3:778433. (Dec 2021)
doi: 10.3389/fagro.2021.778433
Hemp (Cannabis sativa L.) production has increased significantly in recent years; however, the crop has been understudied in the U.S. since its production declined in the late 1950s. Disease identification and management is an increasing challenge for hemp growers across the country. In 2019, beet curly top virus (BCTV) was first reported in hemp in Colorado. Hence, we were motivated to understand the diversity and prevalence of BCTV strains infecting hemp in Colorado. We detected BCTV at high incidence rate (81%) in leaf samples from 12 counties. Two different strains of BCTV, Worland (Wor) and Colorado (CO) were present as a single ormixed infection in hemp leaf samples. Phylogenetic analysis revealed BCTV sequences from hemp formed a distinct group along with BCTV strains CO and Wor. To determine other potential viral and viroid pathogens in hemp, we performed next generation sequencing (NGS). Virome analysis revealed the presence of both virus and viroid sequences that had high nucleotide sequence identity with GenBank accessions for cannabis cryptic virus, cannabis sativa mitovirus, citrus yellow vein associated virus, opuntia-like virus and hop latent viroid. In contrast, tobacco streak virus sequences were highly variable compared to sequences in GenBank suggesting a possible new genotype of this virus. The data presented here has important implications for the epidemiology andmanagement of the various diseases of hemp and will lead to the development of integrated pest management strategies designed to interrupt transmission cycles and facilitate efficient crop production.
First report of anthracnose leaf spot caused by Colletotrichum fioriniae on hemp (Cannabis sativa).
Szarka, D., McCulloch, M. J., Beale, J., Long, S., Dixon, E., & Ward Gauthier, N. A.
(2019). Plant Disease.
doi:10.1094/pdis-10-19-2216-pdn
In August 2018, a field hemp sample with leaf spots was submitted to the University of Kentucky Plant Disease Diagnostic Lab from Jackson County, KY. Leaf spots affected all plants in the field, with spots forming on the lower half of plants in early August as plants entered the reproductive stage. Disease
severity on mature leaves was approximately 20%, and incidence was 100% of plants in the field. All three cultivars in the field were equally affected: ‘Cherry x Cherry,’ ‘Trump 1,’ and ‘Sweetened.’ Symptoms included numerous, scattered, round leaf spots that expanded to necrotic blotches. Spots began as light green specks and developed into round or angular spots with tan centers. Spots were circular but occasionally became irregular as they expanded, reaching 3 to 4 mm in diameter with a darker brown margin and yellow halo. Centers of spots cracked or dropped out, causing shothole or
frog-eye symptoms. Spots sometimes coalesced to form necrotic regions up to 20 mm across. Necrotic areas on or near leaf margins resulted in symptoms typical of anthracnose leaf diseases on other hosts, such as of scorching, puckering, and twisting.
First Report of Beet Curly Top Virus Infecting Industrial Hemp (Cannabis sativa) in Arizona.
Hu, J., Masson, R., & Dickey, L.
Plant Disease.(2020).
doi:10.1094/pdis-11-20-2330-pdn
Industrial hemp (Cannabis sativa) is an emerging crop in Arizona, with many uses, including fiber, cosmetic products, and health food. In 2020, severe curly top disease outbreaks were observed in several hemp fields in Yuma and Graham Counties, Arizona, where disease incidence and severity were considerably high, up to 100% crop loss occurring in some fields. A wide range of symptoms have been observed at different infection stages and plant growth stages at the time of infection. Early stage symptoms manifested as light green-to-yellowing of new growth, similar to sulfur or micronutrient deficiency, usually combined with older leaves with dark green “blotchy” mosaic mottling overlaying light green chlorosis. Mosaic mottling of older leaves continued into mid-growth stage, and was coupled with more severe yellowing and witch’s broom (stunted leaves and shortened internode length of stem) of apical meristematic tissue. Curling and twisting of new leaves had also been observed. Symptoms often appeared to be isolated to individual branches, with other branches showing no visual symptoms, often outgrowing and covering affected branches until harvest. Late stage symptoms included severe leaf curling with or without twisting, continued stunting, and necrosis of yellow leaves, resulting in significant yield reduction. Severely affected plants dwarfed by the virus experienced high mortality rates later into the season, most likely attributed to reduced ability to overcome abiotic stress conditions. These
symptoms indicated the likelihood of curly top caused by Beet curly top virus (BCTV), which has been recently reported in Colorado (Giladi et al., 2020).
First Report of Beet Curly Top Virus Infecting Cannabis sativa L., in Western Colorado.
Giladi, Y., Hadad, L., Luria, N., Cranshaw, W., Lachman, O., & Dombrovsky, A.
Plant Disease. (2019).
doi:10.1094/pdis-08-19-1656-pdn
In industrial hemp (Cannabis sativa L.) fields located in North Fork Valley, Delta County Colorado USA, plants bearing symptoms of stunted growth and yellowing leaves were observed in each growing season between 2015-2019. Infected plants display initially fading leaf color to pale green, starting at the leaf base and expanding towards the tips, producing a yellow-green mosaic pattern (Fig. 1). Within ten days, the symptoms spread to the entire plant. In plants with advanced symptoms, newly developing leaves were pale green, narrower and, curled sideways, leading to a stunted, curled plant. Infection was observed in several different hemp cultivars at different developmental stages, from the vegetative to the flowering stages. To identify the infectious agent, leaves were collected from one symptomatic hemp plant and one non-symptomatic hemp plant on 30 July, 2018 and blotted onto FTA cards (Ndunguru et al. 2005). Nucleic acids extracted from FTA cards and subjected to ribosomal RNA depletion, served for library construction as previously described (Luria et al. 2019) using ScriptSeq™ Complete Kit (Plant Leaf, Illumina, San Diego, CA, USA) and sequenced using Illumina Hiseq 2500, at the Technion Genome Center, Israel. The obtained clean reads were searched for viral sequences using VirusDetect software version 1.7. VirusDetect software involved a pipeline combining de novo assembly with mapping to references of plant viruses from Genbank using Velvet (Zerbino and Birney, 2008). This analysis revealed 31 contigs, which aligned to the entire 2,931 nucleotides of Beet curly top virus (BCTV, Geminiviridae Family, Curtovirus genus), sharing 96.5% and 96.4% identity with the genome sequence of isolates AY134867 and KX867020 detected in B. Vulgaris in 2002 and 2006 respectively. In order to validate the NGS findings, the nucleic acids were used as a template for PCR analysis using several specific primer pairs designed to cover most of the BCTV genome. A selected primer set was used for diagnostics: Forward-337-5'…ATGGGACCTTTCAGAGTGGA…3'; Reverse-1,278- Page 2 of 5 5’…TGTATGCCACATTGTTTGGC…3'. Seven symptomatic hemp plants and three nonsymptomatic plants were tested by PCR using the designed BCTV-specific primers. The PCR products were sequenced by Sanger method (HyLabs, Rehovot, Israel) and assembled, resulting in alignment with the majority of BCTV genomes. Importantly, sequences homologous to BCTV were present only in the leaves of the seven symptomatic hemp plants. The complete HTS-derived viral genome sequence was deposited in GenBank (accession No. MK803280) under the name BCTV-Can. There are several strains of BCTV that infect more than 300 plant species and many agricultural crops including beans, sugar beet, cucumber, peppers, spinach and tomatoes (Strausbaugh and Ejayl 2017). BCTV causes symptoms throughout the western United States and sporadic outbreaks occur in western Colorado, where the symptomatic plants described here were located. The virus is solely transmissible by leafhopper vectors and the only known vector of this pathogen in North America is Neoaliturus (=Circulifer) tenellus (Baker) (Hemiptera: Cicadellidae), known as the beet leafhopper (Bennett 1967). BCTV did not appear in the review of hemp diseases by McPartland et al. (2000) and to the best of our knowledge; this is the first report of BCTV infecting hemp and the first report of any leafhopper-vectored pathogen
First Report of Branched Broomrape (Phelipanche ramosa) on Celeriac (Apium graveolens) in Eastern France
Stéphanie Gibot-Leclerc
Plant Disease 98(9):1286 September 2014
DOI: 10.1094/PDIS-02-14-0148-PDN
Branched broomrape, Phelipanche ramosa (L.) Pomel (syn. Orobanche ramosa L.), is a chlorophyll-lacking, obligate root parasitic plant that infests Brassicaceae, Solanaceae, and legumes (3). In western France, P. ramosa has invaded oilseed rape fields since the 1990s, causing significant yield losses (1). This crop has now become the primary host for the parasite, along with buckwheat (Fagopyrum esculentum L.), hemp (Cannabis sativa L.), and tobacco (Nicotania tabacum L.). In September 2013, a field survey indicated that a celeriac (Apium graveolens L. var. Prinlz) crop on clay soil in the Champagne-Ardennes region
(48°20?19? N, 04°01?57? E, 140 m above sea level, eastern France) was infested with branched broomrape where hemp had been grown 4 years before. The celeriac field was planted to wheat (Triticum aestivum L.) in 2012 in rotation with lentils (Lens culinaris Medik.) in 2011. About 2% of the total celeriac field was infested and the estimated yield losses were approximately 25% for this infested area. The host symptoms observed were a slower growth of celeriac, along with leaf chlorosis, lower fruit production, and numerous abortions. The infestation of the celeriac crop was confirmed by verifying the attachment of branched broomrape to the celeriac roots. Broomrape plant heights were between 4.5 and 21 cm. The stems were erect, branched, frail, rather hairy, and bulging. Scale leaves were limited to 4 to 10 mm long, thick, acuminate, alternate scales. The flowers were numerous (between 4 and 51) and were 8.3 to 14.5 mm long. They were borne in the axils of scaly bracts. They had an irregular, curved shape, and a light mauve color. They did not have distinct peduncles and were grouped in rather long floral scapes during advanced flowering. The corolla tube was 10 to 15 mm long and its restricted part stood higher than the divisions of the calyx. It had ciliate, if not hairy, lobes. The calyx was more or less hairy, zygomorphous, with four lobes, and 6 to 8 mm long. Two bracteoles were situated on either side of the calyx. The four stamens observed were didynamous and borne 4 to 5 mm above the corolla base. The dorsifixed bilocularis, longitudinally dehiscent anthers were glabrous or covered with a fine down along sutures. Georges Sallé, (retired) Professor of Botanics at the University Pierre et Marie Curie, Paris, confirmed the identity of P. ramosa based on morphological characteristics (1). Celeriac infection by branched broomrape was confirmed using a developed assay (2). P. ramosa infecting celeriac roots was described by counting the numbers of individuals having reached ontogenic stages according to Gibot-Leclerc et al. (2). To our knowledge, this is the first study reporting P. ramosa infection on celeriac in eastern France. Since celeriac is produced in rotation with lentils, branched broomrape could pose a serious threat to production of these crops.
First report of 'Candidatus Phytoplasma trifolii' associated with a witches' broom disease in Cannabis sativa in Nevada, USA
X. Feng, M. Kyotani, S. Dubrovsky, and A.-L. Fabritius
Plant Disease Vol. 103, No. 7 July 2019
DOI: 10.1094/PDIS-01-19-0098-PDN
In September 2018, symptoms including leaf curling, mottling, chlorosis, witches’ broom, stunting, and node shortening were detected in Cannabis sativa L. plants at two growing sites in Central and Southern Nevada, U.S.A., respectively. Incidence of the disease varied between 5 and 20% at the growing site in Central Nevada, and 30% of plants were affected at the growing site in Southern Nevada. Symptomatic leaves showed “green islands” that were constrained by the veins on the upper leaf surface, and interveinal discoloration on the lower surface, forming a pale “pustule-like” appearance. One infected plant with 80% of leaves exhibiting symptoms was sampled from the Central Nevada site. One infected plant with 50% of leaves exhibiting symptoms was sampled from the Southern Nevada site. Two nonsymptomatic plants were provided by a local grower in California. Total DNA was extracted from the petioles of the most symptomatic leaves. DNA extracted from nonsymptomatic plants was used as the negative control.
First report of Cercospora cf. flagellaris on industrial hemp (Cannabis sativa) in Kentucky
March 2019 Plant Disease
Vinson P Doyle, Hannah Tonry, Bernadette Amsden, Julie Beale, Ed Dixon, Hua Li, Desiree Szarka, Nicole Gauthier
DOI: 10.1094/PDIS-01-19-0135-PDN
In 2015 and 2016, a leaf spot disease was observed in industrial hemp fields in Kentucky during mid-summer as plant canopies became dense. Leaf spots were first visible on older leaves in the lower canopy, but disease quickly spread throughout the canopy. Early symptoms included small individual yellow flecks on upper sides of leaves. Lesions increased in size but retained a round shape. Centers of lesions turned to tan and then to lighter shades of tan or white with age and reached a maximum of 2-6 mm in diameter with raised dark brown to purplish borders and yellow halos; some spots coalesced as disease progressed. Clusters of melanized conidiophores became visible with the unaided eye in centers of spots before the centers disintegrated
First Report of Cercospora Leaf Spot Caused by Cercospora cf. flagellaris on Industrial Hemp in Florida
M. V. Marin, J. Coburn, J. Desaeger and N. A. Peres
Plant Disease Vol. 104, No. 5 May 2020
DOI: 10.1094/PDIS-11-19-2287-PDN
During a greenhouse (July to September) and a field trial (October to December) in 2019, leaf spots were observed on up to 60% of leaves of hemp plants (Cannabis sativa). Symptoms started on older leaves and eventually spread throughout the canopy. Infections began with small yellow, individual flecks. Lesions developed to turn light tan, or even white, with yellow halos and fascicles of conidiophores were visible to naked eye at the center. Severely infected leaves usually developed chlorosis (yellowing), which lead to premature defoliation. Diseased leaves were surface sterilized with 10% bleach solution for 90 seconds and isolation was performed on General Isolation (GI) medium (Forcelini et al. 2016). Resulting colonies were whitish to gray after incubation in a growth chamber at 25°C, 12/12 photoperiod. Isolates were single- spored and resulting colonies were transferred to carrot-agar (CA) and PDA+6% sucrose where they appeared brown- to- dark color due to sporulation (Figure 1) (Leslie and Summerell 2006).
First Report of Chaetomium globosum Causing a Leaf Spot of Hemp (Cannabis sativa) in Tennessee
A. G. Chaffin, M. E. Dee, S. L. Boggess, R. N. Trigiano, E. C. Bernard, and K. D. Gwinn
Plant Disease Vol. 104, No. 5 May 2020
DOI: 10.1094/PDIS-08-19-1697-PDN
Cultivation of hemp (Cannabis sativa), a crop grown for food, fiber, biofuel, and natural medicine worldwide, has increased in the southeastern United States. Pilot and research programs were legalized in 2014, and hemp was removed from the list of Schedule I controlled substances in 2018 (Agriculture Improvement Act of 2018; Mead 2019). Little is known about hemp pathogens, but pathogens of marijuana strains grown in controlled environments were recently described (Punja et al. 2019). Symptomatic plants were found in the North Greenhouse at the University of Tennessee, Knoxville, TN, in September 2017. Leaf spots began as chlorotic lesions near the margins and progressed to necrotic lesions with chlorotic halos. Leaves with chlorotic and necrotic lesions were collected from three 4-month-old plants of two fiber hemp cultivars, Fedora 17 and Futura 75.
First Report of Charcoal Rot Caused by Macrophomina phaseolina on Hemp (Cannabis sativa L.) Varieties Cultivated in Southern Spain
S. Casano, A. Hern.ndez Cotan and M. Mar.n Delgado,
Plant Disease 102(8), 1665
DOI: 10.1094/PDIS-02-18-0208-PDN
In June 2015 and July 2016 charcoal rot symptoms were observed in plants of different industrial and medicinal hemp varieties grown in two different fields located in Southern Spain (Los Chapatales and Alcal. del R.o, Seville). In Los Chapatales, disease incidence was 22% in variety Futura 75. In Alcal. del R.o, the medicinal hemp varieties Sara and Aida (disease incidence: 25.5% and 37.1%, respectively) were more susceptible than varieties Theresa (3.8%), Pilar (3.2%), and Juani (2.7%). In both fields, affected plants developed a systemic chlorosis, rapidly wilted, showed necrosis and died. Before the stalk was completely desiccated, internal tissues appeared soft and fluffy. Discoloration of the stalk was detected near the soil line where small black sclerotia were observed. Roots were necrotic with areas of brown-violet color of unprotected vascular cambium.
First Report of Curvularia pseudobrachyspora Causing Leaf Spot on Hemp ( Cannabis sativa ) in Florida
M. V. Marin, N.-Y. Wang, J. Coburn, J. Desaeger and N. A. Peres
Plant Disease October 7 2020
https://apsjournals.apsnet.org/doi/f...03-20-0546-PDN
DOI: 10.1094/PDIS-03-20-0546-PDN
Hemp (Cannabis sativa L.) is an emerging crop in Florida, with potential use in a variety of commercial and industrial products, including rope, textiles, bioplastics, and insulation. During a field trial in 2019 (October to December) in Wimauma, FL, leaf spots were observed on up to 70% of one-month-old hemp plants on several varieties, such as 'Pumma-2', 'Eletta Campana', 'Carmagnola Selezionata', and 'Tygra' with up to 50% leaf damage in the field. Symptoms started on young and old leaves with small yellow spots that eventually turned tan to brown with a yellow halo. Pieces of diseased leaf tissue were surface sterilized with a 10% bleach solution for 90 s, rinsed twice with sterile deionized water, and then placed on General Isolation medium (Forcelini et al. 2016). The plates were kept in a growth chamber at 25°C under a 12/12 photoperiod. Fungal colonies with sparse aerial mycelium, fimbriate margins, and pale light gray zones or alternate gray olivaceous-to-brown zones on the surface were consistently isolated and single-spored. Four isolates were selected for identification and pathogenicity tests.
First Report of Crown and Root Rot Caused by Pythium aphanidermatum on Industrial Hemp (Cannabis sativa) in Arizona
Jiahuai Hu and Robert Masson
Plant Disease March 2021
https://apsjournals.apsnet.org/doi/p...01-21-0065-PDN
During July and August 2020, symptoms of leaf yellowing and browning, sudden wilting, and death were observed on industrial hemp plants (Cannabis sativa L.) in several drip-irrigated fields in Yuma and Graham county, Arizona. About 85% of plants showed severe crown and root rot symptoms. A high percentage of affected plants collapsed under intensive heat stress. Shriveled stem tissue with necrotic lesions can often be seen at the base of the plant, extending upwards more than 5 cm. Internal tissue of main stem and branches was darkened or pinkish brown. Outer cortex of root bark was often completely rotten, exposing the white core. Cottony aerial mycelium was visible on the surface of stalk of some of
the infected plants in two fields in Yuma. To identify the causal agent, a total of twenty symptomatic plants were collected from several fields across the state. Crown and root tissues from affected plants were harvested and rinsed in tap water to remove soils.
First Report of Crown and Root Rot Caused by Pythium myriotylum on Hemp (Cannabis sativa) in Arizona
Jiahuai Hu
Plant Disease 2021
https://apsjournals.apsnet.org/doi/p...12-20-2712-PDN
During August and September 2020, symptoms of leaf chlorosis, stunting, and wilting were observed on
indoor hemp plants (Cannabis sativa L. cv. ‘Wedding Cake’) in a commercial indoor facility located in
Coolidge, Arizona. Plants were grown in soilless coconut coir growing medium (Worm Factory
COIR250G10), watered with 1.5 to 2.1 liters every 24 h through drip irrigation, and supplemented with
18 h of lighting. About 35% of plants displayed symptoms as described above and many symptomatic
plants collapsed. To identify the causal agent, crown and root tissues from four symptomatic plants were
harvested and rinsed with tap water. Tissue fragments (approx. 2 to 4 mm in size) were excised from the
margins of the stem and root lesions, surface sterilized in 0.6% sodium hypochlorite for 1 min, rinsed
well in sterile distilled water, blotted dry, and plated on potato dextrose agar (PDA) and on oomyceteselective
clarified V8 media containing pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene
(PARP). Plates were incubated at room temperature (21-24 oC). Five isolates resembling Pythium were
transferred after 3 days and maintained on clarified V8 media. Morphological characteristics were
observed on grass blade cultures (Waterhouse 1967). Grass blades were placed on CV8 inoculated with
the isolate. After a 1-day incubation at 25°C, the colonized blades were transferred to 8 ml of soil water
extract in a Petri dish.
First Report of Diaporthe phaseolorum Causing Stem Canker of Hemp (Cannabis sativa)
M. V. Marin, N.-Y. Wang, J. D. Coburn, J. Desaeger and N. A. Peres
Plant Disease (2021)
https://apsjournals.apsnet.org/doi/p...06-20-1174-PDN
Hemp is an annual herbaceous plant that is used for its fiber and oil in a variety of commercial and industrial products. In Florida, it is currently being explored as a new specialty crop. During a field trial from October to January 2019 in Wimauma, FL, a stem canker was observed on up to 60% of three-month-old plants of 'Eletta Campana', 'Carmagnola Selezionata', and 'Tygra'. Symptoms started on the main stems with light-to-dark brown lesions of different sizes and shapes. Over time, the lesions coalesced into large necrotic areas and bore pycnidia. Isolations were made from diseased stem tissues on General Isolation medium (Amiri et al. 2018) after surface disinfestation (Marin et al. 2020). The plates were placed in a growth chamber at 25°C under a 12/12 photoperiod. A fungus with white, floccose, aerial mycelium and pycnidia producing alpha and beta conidia was consistently isolated. Three single spore isolates were chosen for identification and pathogenicity tests.
First Report of Exserohilum rostratum Causing Foliar Blight of Industrial Hemp (Cannabis sativa L.)
Lindsey Thiessen, Tyler Schappe
January 2019 Plant Disease
DOI: 10.1094/PDIS-08-18-1434-PDN
In the 2017 and 2018 growing seasons (between May and October), industrial hemp plants of several cultivars including those grown for fiber, seed, and flower from numerous counties in North Carolina showed foliar, stem, and floral blight symptoms. Plants were collected from samples submitted to the North Carolina State University Plant Disease and Insect Clinic. Lesions on leaves were round, brown to black, with dark margins. Inside of each lesion, abundant conidia were found. Conidia were rostrate, ellipsoidal to narrowly obclavate, straight or slightly curved, olive-brown, with a protuberant, cylindrical hilum at the base. Conidia were 7 to 12 septate and 75.64±8.31× 15.61±1.41 µm. Conidiophores were cylindrical, olivaceous-brown with swollen conidiogenous cells containing circular conidial scars. Isolates were obtained by transferring single spores to water agar and then transferring to potato dextrose agar.
First Report of Fusarium falciforme (FSSC 3+4) Causing Rot of Industrial 2 Hemp (Cannabis sativa) in California.
K. R. Paugh, J. Del Castillo Múnera, and C. L. Swett
https://apsjournals.apsnet.org/doi/p...08-21-1640-PDN
Industrial hemp (Cannabis sativa) is a newly legal crop in California that is grown for cannabidiol oil, fiber and seed. In August 2019, whole plant decline and root rot were observed affecting <5% of plants in two industrial fields in Fresno County, CA. Symptoms included chlorotic, collapsed foliage, stem vascular discoloration, and root rot with abundant mycelial growth. Stem and root segments (1-2 cm) from three to five diseased plants were agitated in 0.1% tween-20 and soaked in 70% ethanol for 30 s and 1% NaOCl for 2 min. After incubating for 5 to 7 days on 1:10 potato dextrose agar (PDA) amended with tetracycline, Fusarium selective medium (FSM), and PARP (pimaricin + ampicillin + rifampicin + pentachloronitrobenzene [PCNB] agar) medium, white to pale cream aerial mycelium emerged from tissue of all plants on PDA and FSM but not PARP. Isolates cultured on 0.1% potassium chloride agar formed heads of microconidia on long monophialides consistent with the Fusarium solani species complex (FSSC) (Leslie and Summerell 2008). To obtain pure cultures of two isolates (CS529 and CS530), a single-hyphal tip was excised and grown on PDA. FSSC was described as causing foot rot in hemp in Italy (Sorrentino et al. 2019), but these isolates belonged to phylogenetic species 5 (F. solani) not F. falciforme. In addition, F. falciforme was reported as causing root rot in hydroponically grown cannabis (Punja and Rodriguez 2018). These studies provide the foundation for development of management tools for hemp disease.
First Report of Fusarium graminearum Causing Flower Blight On Hemp (Cannabis sativa) in Kentucky
Gabdiel E. Yulfo-Soto, Henry Smith, Desiree Szarka, Ed Dixon, Lisa J. Vaillancourt, Nicole Gauthier
Plant Disease 2021 july
https://apsjournals.apsnet.org/doi/p...06-21-1292-PDN
In October of 2020, a grower in Boyle County, KY, reported mold and blight symptoms on flowers of field-grown hemp. Plants were approaching harvest, and the mold was affecting 100% of the cultivar ‘White CBG’ being grown for cannabinoid (CBD) extraction. Mycelium colonized the flower heads and any seeds within bracts. Affected flower bracts were necrotic, and mycelium and necrosis in the most severe cases also encompassed adjacent (sugar) leaves. Necrotic symptomatic tissue was collected, disinfested in 10% bleach for one minute, and cultured on acidified potato dextrose agar (APDA). Each isolate was single-spored, transferred to PDA, stored in 15% glycerol at -80°C and maintained at room temperature under blacklight blue and fluorescent bulbs on a 12-hour light-dark cycle. Colonies produced white-pink mycelia with a dark red pigment on the undersides. Conidia collected after 7-9 days were falcate and septate (5 to 6). No microconidia were produced. Macroconidia measured 35.4-49.7 µm x 3.4-22 5.8 µm (n=50).
First report of Powdery Mildew Caused by Golovinomyces ambrosiae on Cannabis sativa in Oregon
Michele S. Wiseman, Taylor A. Bates, Andrea R. Garfinkel, Cynthia M. Ocamb, David. H. Gent
Plant Dis. 2021 Feb 2.
doi: 10.1094/PDIS-11-20-2455-PDN
https://apsjournals.apsnet.org/doi/p...11-20-2455-PDN
Oregon is the second largest producer of hemp in the United States with 25,900 ha of hemp licensed to growers in 2019, a nearly six-fold increase over the previous year (Perkowski 2019, Capital Press). Industrial hemp has a wide range of uses including textiles to nutritional supplements; in Oregon, hemp has become one of the most economically promising crops and is mainly cultivated for cannabidiol (CBD) production. Between 2018 and 2019, multiple independent greenhouse growers in western Oregon reported powdery mildew-like signs and symptoms on leaves and buds of several Cannabis sativa cultivars, including ‘Cherry Wine’
First report of Fusarium proliferatum causing crown and stem rot, and pith necrosis, in cannabis (Cannabis sativa L., marijuana) plants
Zamir K. Punja
Canadian Journal of Plant Pathology 2021 Vol. 43, No. 2, 236–255,
DOI: 10.1080/07060661.2020.1793222
https://www.tandfonline.com/doi/pdf/...eedAccess=true
Cannabis (Cannabis sativa L., marijuana) plants grown under greenhouse or controlled environments with symptoms of leaf yellowing, leaf necrosis and defoliation were observed during 2018–2019. Additional symptoms included crown rot and internal browning or blackening of the pith tissues. Stock (mother) plants as well as plants in the vegetative and flowering stages of 15 cannabis strains (genotypes) were affected. In addition, damping-off symptoms were observed on rooted cuttings in propagation rooms. Isolations from diseased tissues yielded predominantly Fusarium proliferatum, with some F. oxysporum also recovered. Phylogenetic analysis of sequences from the translation elongation factor 1α (TEF-1 α) region of 29 isolates of F. proliferatum from eight licenced production facilities in three provinces in Canada (British Columbia, Ontario and New Brunswick), and one cannabis production site in northern California, grouped isolates from cannabis with a large clade of isolates from a wide range of other hosts in different geographic regions. Pathogenicity studies confirmed the ability of F. proliferatum to cause symptoms of wilting, leaf and pith necrosis, and plant death on cuttings, rooted plants and stock plants. Inoculated tomato and cucumber plants developed similar symptoms. Stem colonization was more extensive by F. proliferatum compared to F. oxysporum on cannabis cuttings. Both grew optimally at 25°C on agar media although F. oxysporum grew faster than F. proliferatum at all temperatures tested. The occurrence of F. proliferatum on cannabis plants has not been previously reported, adding to recent reports of F. oxysporum
First report of Golovinomyces cichoracearum sensu lato on Cannabis sativa in Israel
M. Maymon, S. Jerushalmi and S. Freeman
New Disease Reports 42, 11.
DOI: 10.5197/j.2044-0588.2020.042.011
https://bsppjournals.onlinelibrary.w.. .8.2020.042.011
In recent years, the use of cannabis (Cannabis sativa) has gained popularity for medical and other purposes, and its cultivation worldwide has expanded rapidly (Ruchlemer et al., 2015; Jerushalmi et al., 2020).
During April 2020, symptoms of powdery mildew were observed on commercially cultivated medical cannabis in the greenhouses of several farms in Israel, causing serious concerns, since affected material was discarded, deemed unfit for medical consumption. Symptoms initially appeared as small, white circular patches of epiphytic mycelia with conidia on the upper sides of mature leaf surfaces, similar to those described by Pépin et al. (2018). As the disease progressed, colonies expanded in size, coalescing and covering entire leaf surfaces, succulent stems and inflorescences (Fig. 1). Conidia were produced in chains on conidiophores that were single and erect, unbranched and cylindrical, arising from the colonies (Fig. 2). The conidia were hyaline, cylindrical to ellipsoid in shape, measuring 38.8-45.4 µm in length and 15.9-21.1 µm in width (Fig. 3). No chasmothecia were observed.
The pathogen was identified by molecular analyses and sequencing of the internal transcribed spacer (ITS) region of rDNA following amplification by PCR using ITS1 and ITS4 primers. Sequences were deposited in GenBank (Accession Nos. MT791387- MT791389), and BLAST analyses revealed 100% identity to Golovinomyces cichoracearum sensu lato, as recently reported from cannabis plants in Canada (Pépin et al., 2018). Due to its complex taxonomy, G. cichoracearum is considered a species complex, composed of specialised as well as less specialised races, taxa or even cryptic species.
First report of Golovinomyces spadiceus causing powdery mildew on industrial hemp (Cannabis sativa L.) in Ohio.
Farinas, C., & Peduto Hand, F.
Plant Disease. (2020).
doi:10.1094/pdis-01-20-0198-pdn
Industrial hemp cultivation is highly valued in North America for oilseed production as well as cannabidiol (CBD), which are considered having many therapeutic qualities (Cherney et al. 2016). The 2018 Farm Bill’s decriminalization of hemp has expanded the ability of states to cultivate and process hemp and transfer hemp-derived products across state lines, paving the way to new business opportunities for US farmers. At the same time, it has incentivized
universities across the nation to engage in hemp research and provide extension services to farmers. In August 2019, patches of white powdery fungal growth typical of powdery mildew were observed covering the older leaves of two-month old plants of Cannabis sativa cv. Tangerine maintained in the research greenhouse of the Department of Plant Pathology at the Ohio State University in Columbus, OH. Approximately 80% of the plants within the greenhouse were affected.
First Report of Hemp Canker Caused by Sclerotinia sclerotiorum in Alberta, Canada
P. S. Bains, H. S. Bennypaul, S. F. Blade, and C. Weeks
Plant Disease Vol. 84, No. 3 March 2000
DOI: 10.1094/PDIS.2000.84.3.372B
Hemp (Cannabis sativa L.) is a herbaceous annual grown mainly for its blast fiber and seed oil. In 1999, Health Canada issued licenses to plant 12,145 ha of hemp in Canada. Of these, 730 ha were in Alberta. During the last week of August, hemp plants (cv. Fasamo) in a central Alberta field showed the following symptoms and signs: wilting foliage turning light brown; dry tan to gray lesions on stems; shredding and breaking of stems at the lesion; presence of white mycelium in the lesion; and black round, irregular, or oblong sclerotia (up to 5 mm diameter and 2 to 11 mm long) present externally at the lesion on the stem and inside the pith cavity. Lesions were found at the crown, near the inflorescence, and along the entire stem length. Disease incidence in a survey of six commercial fields (40 ha) ranged from 1 to 8%. The organism isolated from lesions on potato dextrose agar produced white aerial mycelia and large numbers of sclerotia characteristic of Sclerotinia sclerotiorum. Pathogenicity was confirmed by inoculating 23-day-old greenhouse-grown hemp plants (cv. Fasamo) with autoclaved wheat grains colonized for 14 days with a S. sclerotiorum culture previously isolated from an infected hemp plant. The grains were placed on soilless growing medium near the plant and covered very lightly. One week after inoculation, grayish lesions appeared on the stems, white mycelia appeared on lesions, and plants wilted. The pathogen was reisolated from the lesions. This is the first report of S. sclerotiorum on hemp in Alberta, Canada. The disease known as hemp canker has been reported to cause severe losses under cool wet conditions in the Netherlands
First Report of Hemp Leaf Spot Caused by a Bipolaris Species on Hemp (Cannabis sativa) in Kentucky.
Szarka, D., Amsden, B., Beale, J., Dixon, E., Schardl, C. L., & Gauthier, N.
Plant Health Progress, 82–84.(2020).
doi:10.1094/php-01-20-0004-br
First Report of Hemp Leaf Spot Caused by a Bipolaris Species on Hemp (Cannabis sativa) in Kentucky
Upon reintroduction of hemp (Cannabis sativa) in 2014, reports of a leaf spot disease became increasingly common in Kentucky. Outdoor-grown plants became severely affected with necrosis and blight symptoms, and many crops were rejected by processors either as a result of leaf and bud necrosis or as a result of reduced levels of cannabidiol. Morphological data and sequences of ITS and partial 28S rDNA identified the pathogen as Drechslera gigantea. Phylogenetic analysis grouped all isolates in a clade within Bipolaris. Dicot and monocot weed hosts within symptomatic fields were also identified. We refer to the disease as Bipolaris leaf spot, but the common reference is hemp leaf spot. This is the first report of a Bipolaris pathogen infecting C. sativa. Widespread distribution, disease severity, and extreme yield losses makes this one of the most important diseases of hemp in Kentucky.
First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.
Ren, Z., Chen, X., Luan, M., Guo, B., & Song, Z.
Plant Disease. (2020).
doi:10.1094/pdis-07-20-1451-pdn
Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24–48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines.
First report of Meloidogyne incognita infecting Cannabis sativa in Alabama
Bisho R. Lawaju, William Groover, Jessica Kelton, Kassie Conner, Edward Sikora and Kathy S. Lawrence
JOURNAL OF NEMATOLOGY e2021-52 | Vol. 53
DOI: 10.21307/jofnem-2021-052
https://www.ncbi.nlm.nih.gov/pmc/art...nem-53-052.pdf
Hemp (Cannabis sativa L.) is a new crop in Alabama. In 2019, symptomatic plants with stunted growth, poor root development, and numerous galls were observed in hemp plants grown in Geneva County, AL. After harvest, soil samples were collected from areas with the symptomatic plants and root-knot nematode (Meloidogyne spp.) were found in the soil. Based on morphological features and the polymerase chain reactions using species-specific primers, it was identified as Meloidogyne incognita. Further, a host differential test in a greenhouse assay confirmed it to be M. incognita race 3. The pathogenicity of the nematode to the hemp was confirmed by a modified version of Koch’s postulates. To our knowledge, this is the first report of M. incognita infecting Cannabis sativa in Alabama.
First Report of Meloidogyne javanica Infecting Hemp (Cannabis sativa) in China.
Song, Z. Q., Cheng, F. X., Zhang, D. Y., Liu, Y., & Chen, X. W.
Plant Disease, 101(5), 842. (2017).
doi:10.1094/pdis-10-16-1537-pdn
Hemp (Cannabis sativa L.) is an important annual herbaceous plant for its bast fiber, seed oil and psychoactive substances. In China, hemp cultivation has more than 6000 years of history, and planting area of seed hemp and fiber hemp accounted for 40-50% of the world total in the last decade (Amaducci et al. 2015). The root-knot nematode Meloidogyne javanica can infect hemp cultivars in South Africa (Pofu and Mashela 2014), but damage to this plant caused by M. javanica has notbeen reported in China until now.
First report of Neofusicoccum parvum causing dieback and canker disease on hemp in the United States
C. Feng, M. I. Villarroel-Zeballos, P. F. Ficheux, H. Zima, B. D.S. Dhillon, J. C. Correll
Plant DiseaseVol. 104, No. 11 November 2020
Doi: 10.1094/PDIS-03-20-0486-PDN
Hemp (Cannabis sativa L.) had been grown as a fiber crop in the U. S. for over 300 years prior to it being banned as schedule 1 drug in 1970 (Small and Marcus 2002). After the farm bill legislation in 2018, hemp was reintroduced as a crop into Arkansas where approximately 700 ha were grown in 2019. In July, on a single farm in Searcy Co., AR, one to two-month old hemp plants (cultivars: Trump and Cherry Wine) were observed with leaf discoloration and curling, and branch dieback with distinct lesion margins on the stem. The dieback was predominantly on the main terminal. Approximately 10% of the plants were observed with dieback symptoms. The infected branches and the whole plants with terminal infections often would die, significantly impacting yield. Small pieces from symptomatic stems and leaves of the field samples were surface sterilized in 10% bleach for one minute, washed in sterile deionized water three times, and then placed on water agar (WA). After three days, mycelia growing out from both leaf and stem tissue was transferred onto potato dextrose agar (PDA) to recover pure cultures. Seventeen isolates recovered from eight separate plants had an identical colony morphology. Seven-day old colonies developed grey aerial mycelia, but no conidia. However, pycnidia, containing a large number of both septate and nonseptate conidia, were found on the WA surface after seven days, or on symptomatic plant tissue incubated in a moist chamber for 48 h. The average size of conidia (n=20) was 22.9±1.6 µM long by 12.8±1.1 µM wide.
First Report of Powdery Mildew Caused by Golovinomyces spadiceus on Industrial Hemp ( Cannabis sativa ) in Kentucky
Desiree Szarka, Lydia Tymon, Bernadette Amsden, Nicole Gauthier, Ed Dixon, Justin Kirk Judy
February 2019 Plant Disease
DOI: 10.1094/PDIS-01-19-0049-PDN
Industrial hemp (Cannabis sativa) was reintroduced to the United States as a pilot research program under the 2014 Farm Bill. By 2017, there were over 25,000 acres of industrial hemp in the United States, with Kentucky having the second highest acreage in the United States (https://www.votehemp.com/resources/publications/). Hemp is processed for fiber (4%), grain/seed (18%), and cannabidiol (CBD, 62%), and grosses $7.5M for Kentucky growers. Between 2014 and 2018, powdery mildew was observed in numerous greenhouses, in multiple locations, and on several varieties including but not limited to Cherry Wine, Endurance, Otto, proprietary CBD varieties, and fiber and grain breeding lines. Symptoms initially appeared as small, inconspicuous white patches on the adaxial side of leaves. Colonies expanded in size, often coalescing and infecting entire leaves and succulent stems. The disease spread readily to asymptomatic plants. Pathogenicity of three isolates collected from hemp specimens was confirmed through touch inoculation where conidia from infected leaves were pressed onto asymptomatic leaves. Inoculated plants were moist chambered for 48 h and maintained in the greenhouse. Symptoms appeared within 6 to 7 days, and morphological features were identical to the original; noninoculated control plants did not develop symptoms. Mycelia were amphigenous and occasionally caulicolous; hyphae were septate with septations 5 to 6 µm apart. Foot cells were cylindrical, measuring (42 to) 57 to 107 (to 120) µm × 9 to 11 µm, followed by one to two shorter cells. Conidiophores were hyaline, singular, and erect, measuring (80 to) 115 to 187 (to 209) µm in length, followed by two to three immature conidia forming a crenate outline. Conidia were catenescent and ellipsoid to ovoid, measuring (29 to) 30 to 39 (to 41) µm × (13 to) 15 to 20 (to 22) µm. Chasmothecia readily formed during autumn, were round and dark brown at maturity, measured (96 to) 109 to 138 (to 159) µm in diameter, and displayed nondescript myceloid appendages. Mature chasmothecia contained five to 15 ovoid-saccate asci, most with short stalks. Asci measured (52 to) 56 to 75 (to 78) µm × (25 to) 29 to 43 (to 50) µm, and each ascus contained two ovoid ascospores measuring (15 to) 18 to 27 (to 32) × (9 to) 11 to 18 (to 19) µm. Morphological characteristics were consistent with descriptions of Golovinomyces spadiceus except that foot cells from these isolates had a wider range of lengths compared with previous reports, 30 to 80 × 9 to 15 µm versus 42 to 116 × 9 to 11 µm (Braun and Cook 2012). Conidial measurements were similar but not identical to G. ambrosiae, which is reported to have a longer conidial length/width ratio (2.0) than G. spadiceus (1.5 to 2.0); these isolates had conidial length/width ratios consistent with G. spadiceus (Braun and Cook 2012). Identification was confirmed by sequencing the 28S and internal transcribed spacer (ITS) regions with primers PM5G/NLP2 for the 3? half of ITS and 28S and ITS5/PM6G for the 5? half of ITS (Bradshaw et al. 2017). Sequence data were deposited into GenBank (MK305282). A GenBank BLAST search resulted in a 100% similarity to G. spadiceus (GenBank accession AB769427) and 97% similarity to G. asterum, G. orontii, and G. cichoracearum. The latter species were eliminated based on strong inconsistences in morphological comparisons. This species was determined to be G. spadiceus based on morphological features and sequence data. This determination is consistent with those of powdery mildew fungi collected from Cannabis in Canada (Pépin et al. 2018). All samples collected during this period were consistent; no other powdery mildew species was identified. This is the first documented report of G. spadiceus causing powdery mildew on hemp in the United States. With recent legalization of hemp in the United States, it is important to document the species and distribution of powdery mildew fungi affecting this crop.
First report of Powdery Mildew Caused by Golovinomyces ambrosiae on Cannabis sativa in Oregon
Michele S. Wiseman, Taylor A. Bates, Andrea R. Garfinkel, Cynthia M. Ocamb, David. H. Gent
Plant Disease (2021)
https://apsjournals.apsnet.org/doi/p...11-20-2455-PDN
Oregon is the second largest producer of hemp in the United States with 25,900 ha of hemp licensed to growers in 2019, a nearly six-fold increase over the previous year (Perkowski 2019, Capital Press). Industrial hemp has a wide range of uses including textiles to nutritional supplements; in Oregon, hemp has become one of the most economically promising crops and is mainly cultivated for cannabidiol (CBD) production. Between 2018 and 2019, multiple independent greenhouse growers in western Oregon reported powdery mildew-like signs and symptoms on leaves and buds of several Cannabis sativa cultivars, including ‘Cherry Wine’.
First Report of Pythium aphanidermatum Crown and Root Rot of Industrial Hemp in the United States
Janna L. Beckerman, Hannah Nisonson, Nicolette Albright, Tom C. Creswell
February 2017 Plant Disease 101(6)
DOI: 10.1094/PDIS-09-16-1249-PDN
During June and July 2015, crown and root rot symptoms were observed on industrial hemp (Cannabis sativa cv. Alyssa and cv. Canda), in research plots in Lafayette, IN. Record setting rainfall in Indiana during June (218.4 mm) and July (162.6 mm), may have factored into this outbreak. Soil type is Crosby-Miami complex alfisol. Symptom development appeared 13 days after sowing with temperatures ranging from 25 to 30°C. Leaves of affected plants were chlorotic, and plants were stunted and often wilted. Brown lesions on roots, and loss of feeder roots were observed when symptomatic plants were removed from soil; symptomatic plants often but not always possessed brown, water-soaked stem lesions. A small percentage of affected plants collapsed, but most persisted in stunted growth. Thin, aerial mycelia were visible on the stem surface of some of the infected plants.
First report of Pythium ultimum causing crown rot in greenhouse grown Cannabis sativa (L.) in California.
Pitman, T. L., Philbrook, R. N., Vetterli, M. R., & Warren, J. G.
Plant Disease. (2020).
doi:10.1094/pdis-10-20-2228-pdn
In April of 2020 cuttings of Cannabis sativa (L.) in a greenhouse in San Mateo County, CA were observed collapsing, and further observation revealed: water-soaked stems, tan discoloration to the cortex, and discolored roots. The greenhouse irrigation system was supplied by a local stream. We collected one liter water samples from: intake pond, reservoir tank, irrigation lines, and local potable water tap. Water samples were filtered and plated as described previously (Rollins et al., 2016). Filter papers were removed after 24 hours. Crown sections from four symptomatic plants and one asymptomatic plant were surfaced sterilized in 10% bleach for five minutes, rinsed in sterile deionized water, cut into fourmillimeter long sections, and plated onto V8 media, then incubated at room temperature for three days. White mycelial growth was observed from foci within the print of the filter paper from all irrigation water samples but not the potable water supply sample. Similar mycelial growth was observed from plated crown tissue from symptomatic plants only. Observation under light microscope revealed characteristics congruent with P. ultimum, including aseptate hyphae and globose sporangia (Watanabe, 2002).
First Report of Pythium ultimum Crown and Root Rot of Industrial Hemp in the United States
Plant Disease
Janna L. Beckerman, Jessica Stone, Gail E. Ruhl, Tom C. Creswell
Plant Disease Apr 2018
DOI: 10.1094/PDIS-12-17-1999-PDN
During June 2016, root rot symptoms were observed on industrial hemp (Cannabis sativacv. ‘Canda’), in research plots in Lafayette, IN. Rainfall in Indiana during June (127.8 mm) of 2016 was similar to previous averages of 116.1, although a severe rainfall event on 4 June (47.2 mm), 2 days after planting, resulted in physical crusting of the soil surface. Symptom development first appeared 14 days after sowing with temperatures ranging from 25 to 30°C. Affected plants were stunted with chlorotic leaves. Most of the symptomatic plants simply persisted in stunted growth. A sampling of 12 symptomatic plants was removed from the soil, and brown, water-soaked root lesions were observed. Plants were rinsed in tap water to remove soil debris and then 1 to 2 in. was clipped from the bottom of each seedling root to use on Pythium selective medium.
First Report of Root Rot and Wilt Caused by Pythium myriotylum on Hemp (Cannabis sativa) in the United States
C. S. McGehee, P. Apicella, R. Raudales, G. Berkowitz, Y. Ma, S. Durocher and J. Lubell
Plant Disease Vol. 103, No. 12 December 2019
DOI: 10.1094/PDIS-11-18-2028-PDN
In September 2018, a hemp plant (Cannabis sativa L. cv. Dinamed) presented severe wilting, root rot, and mortality in a research greenhouse at the University of Connecticut in Storrs, CT. The hemp plant was grown in a 11.36-liter container with soilless peat-based potting mix (SunGro Fafard 3B, Agawam, MA, U.S.A.). The plants were in a polycarbonate greenhouse with a daytime heating set point of 20°C and a ventilation set point of 26°C under 18 h of supplemental lighting. Roots were collected from the symptomatic hemp plant, washed three times with sterile deionized water, blotted dry, and plated on PARP selective medium (Jeffers and Martin 1986). The plates were incubated in the dark at 21°C for 48 h. Mycelia resembling the morphology of Pythium species were observed in all plates.
First Report of Serratia marcescens Causing a Leaf Spot Disease on Industrial Hemp (Cannabis sativa L.).
Schappe, T. L., Thiessen, L., Ritchie, D. F., & Thiessen, L. D.
Plant Disease. (2019).
doi:10.1094/pdis-04-19-0782-pdn
In the 2017 and 2018 growing seasons (between May and October), several cultivars of industrial hemp plants grown for flowers in greenhouse production from four North Carolina counties showed symptoms of an angular leaf spot on leaves, stems, and flower parts. Lesions were initially small, dark brown, 1 to 3 mm in size, and vein-limited. As the disease progressed, lesions coalesced to form larger regions of necrosis that engulfed large portions of leaves, and whole plants were lost to disease. Red bacterial ooze was observed streaming from the plant tissues.
First Report of Sclerotinia Crown Rot Caused by Sclerotinia minor on Hemp
S. T. Koike, H. Stanghellini, S. J. Mauzey and A. Burkhard
Plant Disease Vol. 103, No. 7 July 2019
DOI: 10.1094/PDIS-01-19-0088-PDN
In summer 2018, commercial field grown hemp (Cannabis sativa L.) plants in San Benito County, CA, showed signs of a disease. Leaves initially wilted and turned dark green. Foliage eventually dried up completely. The base of the plant crown in contact with soil supported the growth of white to gray mycelium and small (0.5 to 3 mm diameter), irregularly shaped, black sclerotia. Crown tissue beneath the epidermis was necrotic. However, plant roots appeared symptomless. To estimate disease incidence, eight replicates of 100 plants each were assessed for collapse symptoms and sclerotia on plant crowns. Overall disease incidence was limited and was approximately 1%. To test for pathogens, symptomatic crown pieces were surface sterilized in 0.006% NaOCl for 2 min and plated on acidified (2 ml of 25% lactic acid/liter) corn meal agar. After 2 to 3 days, rapidly growing, colorless, appressed mycelium emerged from crown pieces
First report of Sclerotinia sclerotiorum causing stem canker on Cannabis sativa L. in Oregon
A.R. Garfinke
CBD Oregon
https://apsjournals.apsnet.org/doi/p...10-20-2142-PDN
In August of 2020, plants of Cannabis sativa L. grown in hoop houses at two farms located in Benton County, Oregon exhibited wilting and chlorosis, followed by shoot necrosis. Symptomatic plants had dry, tan-brown lesions or cankers, often accompanied by large, round to irregular or ribbon-shaped, black sclerotia and/or profuse white mycelial growth. Lesions or cankers were observed on the stems at both the plant crown (soil) level and higher in the canopy; flower infections were not observed. Sclerotia were removed from two infected plants and placed on potato dextrose agar (PDA) at room temperature. Fast-growing, pure white, largely appressed, sterile mycelium grew radially from plated sclerotia. Hyphal tips were transferred to obtain a pure culture. Additional sclerotia, solitary and aggregate, approximately 30 to more than 50 per plate, exhibiting identical features to those observed on plant tissue, formed in culture 6-7 days following transfer and ranged in size from 2 to 11 mm in length or width (n=50). Mycelia were aseptically harvested from cultures for DNA extraction (Quick-DNA Plant/Seed Miniprep Kit, Zymo Research). Primers ITS1-F (Gardes and Bruns 1993) and ITS4 (White et al. 1990) were used to amplify the internal transcribed spacer region (ITS) and primers G3PDHfor and G3PDHrev were used to amplify the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene (Staats et al. 2005) from a single isolate, LAS01. The ITS region from LAS01 (MW079844) shared 100 to >99% homology to several Sclerotinia species isolates in GenBank
First Report of Southern Blight Caused by Sclerotium rolfsii on Hemp (Cannabis sativa) in Sicily and Southern Italy.
Pane A, Cosentino SL, Copani V, Cacciola SO
Plant Dis. 2007 May;91(5):636.
doi: 10.1094/PDIS-91-5-0636A
Hemp (Cannabis sativa L.), family Cannabaceae, is an annual herbaceous plant that is 1.5 to 4.0 m tall and native to the Caucasus Region, northern India, and Iran. It is cultivated in warm to temperate regions worldwide for its fiber, oil, and psychoactive substances. In Europe, commercial plantings have decreased from 52,872 ha in 1989 to 18,716 ha in 2005. Recently however, cultivation of hemp as a natural fiber species has been encouraged by European Union policy (2). During the summer of 2003, patches of dead plants were observed in test plots of 12 monoecious and dioecious hemp cultivars (Beniko, Epsylon 68, Felina 34, Ferimon, Fedora 17, Futura 75, Bialobrzeskie, Dioica 88, Fibranova, Tiborszallasi, Lovrin, and Carmagnola) in an experimental field near Catania (eastern Sicily) previously planted to artichoke (Cynara scolymus L.). Plots were irrigated with a drip irrigation system. Symptoms were first detected in July with day/night temperatures between 35 and 26°C. Infected plants showed a dark brown-to-tan discoloration of the stem near the soil line. As disease progressed, the rot extended down to the crown and taproot, foliage became yellow, and the entire plant eventually collapsed. An extensive white, cottony mycelium and numerous spherical tan-to-dark brown sclerotia (0.5 to 4.0 mm in diameter) developed externally on infected tissues and soil. As much as 60% of the plants were affected in a single plot. Monoecious cultivars that had been planted earlier escaped the disease. Isolations from diseased tissues were performed by plating symptomatic tissues previously disinfected for 1 min in 1% NaOCl and rinsed in sterile water on acidified potato dextrose agar (pH 4.5). Isolations consistently yielded a fungus whose characters corresponded to Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough). Pathogenicity of two isolates obtained from infected plants was confirmed by inoculating 120-day-old hemp plants grown in individual pots. Twenty plants for each of the above listed cultivars (10 plants for each isolate) were inoculated by applying toothpick tips (5 mm) colonized by S. rolfsii to the lower part of the stem. Ten noninoculated plants served as controls. Plants were kept in a greenhouse with temperatures between 26 and 32°C and 95% relative humidity. High soil moisture was maintained with frequent watering. All inoculated plants showed blight and basal stem rot after 2 weeks, irrespective of the cultivar. By the third week, plants began to dry up and mycelium and sclerotia developed on the crown. Noninoculated controls remained symptomless. S. rolfsii was reisolated from inoculated plants. Although S. rolfsii has been reported on hemp in India since the 1930s (3), to our knowledge, this is the first report of southern blight caused by this fungus on C. sativa in Sicily and southern Italy. Residues of artichoke, a very susceptible host of S. rolfsii (1), might have been the source of inoculum for this outbreak on hemp. Most likely, high summer temperatures and overirrigation exacerbated the disease severity.
First Report of white root rot of hemp (Cannabis sativa L.) caused by Dematophora necatrix in Campania region (Southern Italy)
R. Sorrentino, G. M. Baldi, V. Battaglia, F. Raimo, G. Piccirillo, E. Lahoz
Plant Dis. 2021 Apr 1
https://apsjournals.apsnet.org/doi/p...07-20-1521-PDN
Industrial hemp (Cannabis sativa L.) was cultivated in Italy until the end of Second World War. Since then, it
has been abandoned and substituted with other crops mainly due to legal restrictions and public concerns.
Public legislation passed in 2016, has allowed for the production of hemp seeds, flowers and fibers (law n.
242/2016). During a 2019 survey on hemp sanitary status in the province of Naples (40°57'6"12 N,
14°22'37"56 E), plants ‘Kompolty’ with symptoms of root rot were observed at a private farm and collected
for further analysis at the phytosanitary laboratory of CREA in Caserta. Death generally occurred within 2-3
weeks after the appearance of the first symptoms, occurring on ca. 10% of plants, consisting of yellowing,
canopy wilt and signs of roots covered with white mycelium and fan-like mycelium under the bark. The causal
agent, was isolated from small root segments were excised from symptomatic plants, the surface was
disinfected with 2% sodium hypochlorite, placed on potato dextrose agar (PDA) amended with streptomycin
sulphate (100mg/L) and incubated in the dark at 25°C for 5 days. Small pieces (2-3 mm) at the edge of the
resulting colonies were sub-cultured onto PDA and incubated at 25°C in the dark for one week. The mycelia
from 15 isolates showed pear-shaped swellings adjacent to the septa.
First Report of Witches'-Broom Disease in a Cannabis spp. in China and Its Association with a Phytoplasma of Elm Yellows Group (16SrV).
Zhao Y1, Sun Q1, Davis RE1, Lee IM1, Liu Q2.
Plant Dis. 2007 Feb;91(2):227.
doi: 10.1094/PDIS-91-2-0227C.
Hemp fiber plants (Cannabis spp.) spread naturally in almost every climate zone in China and have a long history of cultivation in the country (1). While hemp stalks provide high-quality fibers for making ropes, clothes, and paper products, hemp seeds are a rich source of edible oil. During the summer of 2004, a disease characterized by witches'-broom symptoms was observed in wild hemp fiber plants growing in suburban Taian, Shandong, China. The diseased plants developed clusters of highly proliferating branches with much shortened internodes and leaves on the affected branches were significantly reduced in size. Phytoplasma infection was suspected in this hemp fiber witches'-broom (HFWB) disease because of the typical symptoms and because of its geographic location where other phytoplasmal diseases such as jujube witches'-broom (JWB), paulownia witches'-broom (PaWB), paper mulberry witches'-broom (PMWB), and Chinese wingnut witches'-broom (CWWB) diseases were previously reported (3,4). Total DNA was extracted from leaves of four diseased and four nearby healthy looking hemp fiber plants. Nested PCR were carried out on the DNA samples using phytoplasma universal 16S rDNA primers (P1A/16S-SR and R16F2n/R16R2) (2). Results revealed that all examined diseased plants were infected by phytoplasma, whereas nearby healthy looking plants were phytoplasma free. Subsequent restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 1.25-kb 16S rDNA R16F2n/R16R2 fragment indicated that the phytoplasma associated with HFWB disease belongs to subgroup 16SrV-B of the elm yellows (EY) phytoplasma group. Nucleotide sequence analysis of the cloned HFWB phytoplasma partial rRNA operon (GenBank Accession No. EF029092), spanning a near full-length 16S rRNA gene and a partial 16S-23S rRNA intergenic spacer, suggested that HFWB phytoplasma is most closely related to JWB and PMWB phytoplasmas, both members of subgroup16SrV-B. To further characterize the HFWB phytoplasma, a genomic segment covering full-length ribosomal protein genes rplV and rpsC was PCR-amplified using primer pair rp(V)F1A/rp(V)R1A (2), cloned, and sequenced (GenBank Accession No. EF029093). The nucleotide sequence of the HFWB phytoplasma rplV and rpsC locus is nearly identical (99.9%) to that of JWB phytoplasma. To our knowledge, this is the first report of a phytoplasmal disease in Cannabis spp. Since HFWB and JWB phytoplasmas share extremely high sequence identity and share the same eco-geographic location, further investigation is warranted to determine whether these two phytoplasmas are actually one species that can infect both plants, an issue having important implications in managing both diseases. References: (1) S. Hong and R. C. Clarke. J. Int. Hemp Assoc. 3:55, 1996. (2) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:337, 2004. (3) Q. Liu et al. Plant Dis. 88:770, 2004. (4) Q. Liu et al. Plant Dis. 89:529, 2005.
Flower and foliage-infecting pathogens of marijuana (Cannabis sativa L.) plants.
Punja, Z. K.
Canadian Journal of Plant Pathology. (2018).
doi:10.1080/07060661.2018.1535467
Flower buds of Cannabis sativa develop as inflorescences (buds) which are harvested and dried prior to sale. The extent to which fungal plant pathogens can colonize the buds prior to harvest has not been previously studied. Flower buds were sampled at various preharvest and harvest time periods during 2015–2017 at locations in British Columbia and Alberta to determine the range of fungi present. Isolated fungi were inoculated onto developing buds to determine the extent of tissue colonization. A pre- and post-harvest internal rot was associated with Botrytis cinerea, causing botrytis bud rot. In addition, two species of Penicillium – P. olsonii and P. copticola – were recovered from pre-harvest flower buds, as well as dried buds, and shown to cause penicillium bud rot. Scanning electron microscopy studies revealed colonization and sporulation on bracts and stigmas of the flower buds by P. olsonii. Several Fusarium species, which were identified using ITS rDNA sequences as F. solani, F. oxysporum and F. equiseti, were isolated from pre-harvest flower buds. These fungi colonized the flower buds following artificial inoculation and caused visible rot symptoms. The most severe symptoms were caused by F. solani, followed by F. oxysporum and, to a much lesser extent, F. equiseti. Powdery mildew infection of the foliage and flower buds was caused by Golovinomyces(Erysiphe) cichoracearum. The pathogen was detected on young vegetatively propagated cuttings and sporulation was abundant on older plants and on flower buds. The various fungi recovered from cannabis flower buds may be present as contaminants from aerially dispersed spores and have the potential to cause various types of pre- and post-harvest bud rot under conducive environmental conditions. Powdery mildew may be spread through aerially disseminated spores and infected propagation materials. Management of these pathogens will require monitoring of the growth environment for spore levels and implementation of sanitization methods to reduce inoculum sources.
Not directly Cannabis related
Fomitopsis betulina (formerly Piptoporus betulinus): the Iceman's polypore fungus with modern biotechnological potential
Małgorzata Pleszczyńska , Marta K Lemieszek , Marek Siwulski , Adrian Wiater , Wojciech Rzeski , Janusz Szczodrak
World J Microbiol Biotechnol (2017) 33:83 . 2017 May;33(5):83.
doi: 10.1007/s11274-017-2247-0
https://www.ncbi.nlm.nih.gov/pmc/art...ticle_2247.pdf
Higher Basidiomycota have been used in natural medicine throughout the world for centuries. One of such fungi is Fomitopsis betulina (formerly Piptoporus betulinus), which causes brown rot of birch wood. Annual white to brownish fruiting bodies of the species can be found on trees in the northern hemisphere but F. betulina can also be cultured as a mycelium and fruiting body. The fungus has a long tradition of being applied in folk medicine as an antimicrobial, anticancer, and anti-inflammatory agent. Probably due to the curative properties, pieces of its fruiting body were carried by Ötzi the Iceman. Modern research confirms the health-promoting benefits of F. betulina. Pharmacological studies have provided evidence supporting the antibacterial, anti-parasitic, antiviral, anti-inflammatory, anticancer, neuroprotective, and immunomodulating activities of F. betulina preparations. Biologically active compounds such as triterpenoids have been isolated. The mushroom is also a reservoir of valuable enzymes and other substances such as cell wall (1→3)-α-D-glucan which can be used for induction of microbial enzymes degrading cariogenic dental biofilm. In conclusion, F. betulina can be considered as a promising source for the development of new products for healthcare and other biotechnological uses.
Fool’s gold: diseased marijuana and cannabis hyperemesis syndrome
Oscar Armando Dorantes
J Investig Med 2021;69:1063–1064.
doi:10.1136/jim-2021-001980
https://jim.bmj.com/content/jim/69/5/1063.full.pdf
I am writing in response to the article by Gajendran et al1 and the editorial by Ron Shay, 'Cannabis hyperemesis syndrome: the conundrum
is here to stay'.2 As an emic cultural investigator (anthropologist) and from my vantage point, the problem of cannabis hyperemesis syndrome could easily go away just as quickly as it has appeared. There is a large disconnect between the professional medical community and the marijuana subculture. The majority of the latter are somewhat in denial that cannabis is the cause of this condition and, on the flip side, doctors feel strongly about their conclusions. Perhaps both can be right, because in the marijuana subculture community there are two types of marijuana: 'the sticky, skunky weed' or the 'the bunk weed', 'the dank or the regs' or otherwise viewed as the 'good stuff versus not good stuff'. Were any of the samples of consumed marijuana analyzed during the marijuana hyperemesis diagnosis, as presented in Gajendran et al's paper?
Fungal Pathogens Affecting the Production and Quality of Medical Cannabis in Israel.
Jerushalmi, S., Maymon, M., Dombrovsky, A., & Freeman, S.
Plants, 9(7), 882. (2020).
doi:10.3390/plants9070882
The use of and research on medical cannabis (MC) is becoming more common, yet there are still many challenges regarding plant diseases of this crop. For example, there is a lack of formal and professional knowledge regarding fungi that infect MC plants, and practical and effective methods for managing the casual agents of disease are limited. The purpose of this study was to identify foliar, stem, and soilborne pathogens affecting MC under commercial cultivation in Israel. The predominant major foliage pathogens were identified as Alternaria alternata and Botrytis cinerea, while the common stem and soilborne pathogens were identified as Fusarium oxysporum and F. solani. Other important fungi that were isolated from foliage were those producing various mycotoxins that can directly harm patients, such as Aspergillus spp. and Penicillium spp. The sampling and characterization of potential pathogenic fungi were conducted from infected MC plant parts that exhibited various disease symptoms. Koch postulates were conducted by inoculating healthy MC tissues and intact plants with fungi isolated from infected commercially cultivated symptomatic plants. In this study, we report on the major and most common plant pathogens of MC found in Israel, and determine the seasonal outbreak of each fungus.
Fusarium and Pythium species infecting roots of hydroponically grown marijuana (Cannabis sativa L.) plants.
Punja, Z. K., & Rodriguez, G.
Canadian Journal of Plant Pathology. (2018).
doi:10.1080/07060661.2018.1535466
An increase in the cultivation of Cannabis sativa (cannabis or marijuana) plants in Canada is becoming associated with increased incidence and severity of various diseases, many of which have not been previously reported. In this study, hydroponically grown C. sativa plants were sampled over a 3-year period (2014-2017) to determine the prevalence of root pathogens. Following isolation, pathogenicity studies were conducted to establish the extent of disease symptoms caused by the recovered microbes. Root rot was found to be caused by two Pythium species - Pythium dissotocum Drechsler and P. myriotylum Drechsler. As well, two Fusarium species were recovered from diseased plants - Fusarium oxysporum Schlecht. emend. Snyder & Hansen and F. solani (Mart.) Sacc. Upon inoculation onto healthy plants, all isolates of Pythium spp. caused browning and a reduction in root mass, accompanied by stunting. Inoculation of plants with F. oxysporum caused browning of roots and crown rot infection, accompanied by pith and vascular discoloration, and in some cases wilting of plants, while root and crown infection was observed with F. solani. Phylogenetic analysis of internal transcribed spacer (ITS) and elongation factor 1 ? (EF-1 ?) sequences revealed that the Fusarium species affecting cannabis plants shared 99-100% sequence homology with isolates causing stem rot and wilt in other hosts, including cumin and tomato, suggesting they were not uniquely adapted to cannabis. The potential for spread of F. oxysporum through the hydroponic system was confirmed by its detection in the recirculating nutrient solution. Furthermore, rooted cuttings obtained from commercial propagators were found to harbor Fusarium root infection that resulted in subsequent stunting, yellowing and occasional death of plants. This demonstrates the potential for long-distance spread of the pathogen. The two Pythium species recovered from cannabis plants have an extremely broad host range and are not unique to this host. An additional species, P. aphanidermatum (Edson) Fitzp., was recovered from diseased plants grown under greenhouse conditions in 2018. The management of these root pathogens on C. sativa will require the evaluation and implementation of sanitization methods, biological
control agents, and chemical products adapted from greenhouse vegetable production practices. The use of pathogen-free propagation materials and identification of potential sources of disease resistance should also become a priority.
Fusarium Oxysporum f. sp. Cannabis Isolated from Cannabis Sativa L.: In Vitro and In Planta Biocontrol by a Plant Growth Promoting-Bacteria Consortium
Marika Pellegrini, Claudia Ercole Carmslo Gianchino, Matteo Bernardi, Loretta Pace and Maddalena Del Gallo
Plants 2021, 10(11), 2436;
DOI: 10.3390/plants10112436
https://mdpi-res.com/d_attachment/pl...0-02436-v2.pdf
Industrial hemp (Cannabis sativa L.) is a multipurpose plant used in several fields. Several phytopathogens attack hemp crops.Fusarium oxysporum is a common fungal pathogen that causes wilt disease in nurseries and in field cultivation and causes high losses. In the present study, a pathogenic strain belonging to F. oxysporum f. sp. cannabis was isolated from a plant showingFusarium wilt. After isolation, identification was conducted based on morphological and molecular characterizations and pathogenicity tests. Selected plant growth-promoting bacteria with interesting biocontrol properties—Azospirillum brasilense,Gluconacetobacter diazotrophicus, Herbaspirillum seropedicae and Burkholderia ambifaria—were tested against this pathogen. In vitro antagonistic activity was determined by the dual culture method. Effective strains (in vitro inhibition > of 50%) G. diazotrophicus, H. seropedicae and B. ambifaria were combined in a consortium and screened for in planta antagonistic activity in pre-emergence (before germination) and post-emergence (after germination). The consortium counteracted Fusarium infection both in pre-emergence and post-emergence. Our preliminary results show that the selected consortium could be further investigated as an effective biocontrol agent for the management of this pathogen
Fusarium Wilt
John M. McPartland, Karl W. Hillig
Dec 22, 2004 Journal of Industrial Hemp· Vol. 9(2) 2004
DOI :10.1300/J237v09n02_07Copy DOI
Fusarium wilt is caused by two closely-related fungi, Fusarium oxysporum f. sp. vasinfectum and Fusarium oxysporum f. sp. cannabis. The disease was first described on hemp in Eastern Europe about 50 years ago, but is now found throughout the Northern hemisphere. Greenhouse studies demonstrated that all cultivars of Cannabis that were tested are susceptible. Signs and symptoms, life history of the pathogens, and control measures are discussed. Fusarium wilt is a menace to hemp cultivation worldwide because its causal fungi cannot be constrained by known organic control measures. The disease threat is compounded by misguided attempts to spread the fungi around the world to stop illicit marijuana cultivation.
Not Cannabis specific
Genetic Engineering of Terpenoid Metabolism Attracts Bodyguards to Arabidopsis
Iris F. Kappers, Asaph Aharoni, Teun W. J. M. van Herpen, Ludo L. P. Luckerhoff, Marcel Dicke, Harro J. Bouwmeester
SCIENCE 23 SEPT 2005 VOL 309
DOI: 10.1126/science.1116232
Herbivore-damaged plants release complex mixtures of volatiles that attract
natural enemies of the herbivore. To study the relevance of individual components of these mixtures for predator attraction, we manipulated herbivoryinduced volatiles through genetic engineering. Metabolic engineering of terpenoids, which dominate the composition of many induced plant volatile bouquets, holds particular promise. By switching the subcellular localization of the introduced sesquiterpene synthase to the mitochondria, we obtained transgenic Arabidopsis thaliana plants emitting two new isoprenoids. These altered plants attracted carnivorous predatory mites (Phytoseiulus persimilis) that aid the plants’ defense mechanisms
It is actually more important to eliminate any MLO susceptibility genes in a Cannabis variety, to have no PM. While the resistance gene PM1 is an important discovery, elimination of any MLO susceptibility genes will confer better protection to PM. Breeding out PM susceptibility genes provides more robust protection than breeding in PM resistance genes
*Genome-wide characterization of the MLO gene family in Cannabis sativa reveals two genes as strong candidates for powdery mildew susceptibility
Noémi Pépin, Francois Olivier Hebert, and David L. Joly
Biorxiv 2021
DOI: 10.1101/2021.07.16.452661
https://www.biorxiv.org/content/10.1...661v1.full.pdf
Cannabis sativa is increasingly being grown around the world for medicinal, industrial, and recreational purposes. As in all cultivated plants, cannabis is exposed to a wide range of pathogens, including powdery mildew (PM). This fungal disease stresses cannabis plants and reduces flower bud quality, resulting in significant economic losses for licensed producers. The Mildew Locus O (MLO) gene family encodes plant-specific proteins distributed among conserved clades, of which clades IV and V are known to be involved in susceptibility to PM in monocots and dicots, respectively. In several studies, the inactivation of those genes resulted in durable resistance to the disease. In this study, we identified and characterized the MLO gene family members in five different cannabis genomes. Fifteen Cannabis sativa MLO (CsMLO) genes were manually curated in cannabis, with numbers varying between 14, 17, 19, 18, and 18 for CBDRx, Jamaican Lion female, Jamaican Lion male, Purple Kush, and Finola, respectively (when considering paralogs and incomplete genes). Further analysis of the CsMLO genes and their deduced protein sequences revealed that many characteristics of the gene family, such as the presence of 7 transmembrane domains, the MLO functional domain, and particular amino acid positions, were present and well conserved. Phylogenetic analysis of the MLO protein sequences from all five cannabis genomes and other plant species indicated seven distinct clades (I through VII), as reported in other crops. Expression analysis revealed that the CsMLOs from clade V, CsMLO1 and CsMLO4, were significantly upregulated following Golovinomyces ambrosiae infection, providing preliminary evidence that they could be involved in PM susceptibility. Finally, the examination of variation within CsMLO1 and CsMLO4 in 32 cannabis cultivars revealed several amino acid changes, which could affect their function. Altogether, cannabis MLO genes were identified and characterized, among which candidates potentially involved in PM susceptibility were noted. The results of this study will lay the foundation for further investigations, such as the functional characterization of clade V MLOs as well as the potential impact of the amino acid changes reported. Those will be useful for breeding purposes in order to develop resistant cultivars.
Hemp and Cannabis Crop Diseases A guide to field diagnosis and management
Shouhua Wang
Nevada Dept of Agriculture
Power Point https://agri.nv.gov/uploadedFiles/ag...management.pdf and also a Book
www.cabi.org/bookshop/book/9781789246070
Defining Hemp: A Fact Sheet
“Botanically, hemp and marijuana are from the same species of plant, Cannabis sativa, but from different varieties or cultivars. However, hemp and marijuana are genetically distinct forms of cannabis that are distinguished by their use and chemical composition as well as by differing cultivation practices in their production. While marijuana generally refers to the cultivated plant used as a psychotropic drug (whether used for medicinal or recreational purposes), hemp is cultivated for use in the production of a wide range of products, including foods and beverages, personal care products, nutritional supplements, fabrics and textiles, paper, construction materials, and other manufactured and industrial goods. Hemp and marijuana also have separate statutory definitions in U.S. law.”
*Hemp Diseases and Pests Management and Biological Control
J.M. McPartland, Robert Connell Clarke, David Paul Watson
CABI Publishing 251 pages
https://avalonlibrary.net/ebooks/Rob...%20Control.pdf
As the 21st century begins, we are favoured with a worldwide resurgence in hemp cultivation. As global forests dwindle to rampikes and timber limits, we see a glimmer of hope for our future, thanks to a renewed interest in this ancient and humble source of food and fibre. This book is our contribution to hemp's revival. Much of the literature regarding hemp diseases and pests dates back 50 years or more. Further, these publications are frequently buried in obscure agronomy journals. Cultivators of illicit Cannabis have published high-calibre research in the last 25 years, but they published in semi-clandestine "grey journals" such as Sinsenzilla Tips. Our primary effort was to collect this scattered bibliography and assimilate it into a comprehensive and readable format.
Our second effort was to manoeuvre the control of diseases and pests into the 21st century. Most hemp research dates to the days when DDT was considered a glamorous panacea. We must find new control methods for sustainable hemp cultivation. Many "new" pesticides are old, such as pyrethrum, a popular insecticide before the days of DDT. Biological control also is old; the use of biocontrol against hemp pests began around 1886, in France. Etre une tete a Papineau, we see biocontrol and hemp resurging together.
Hemp Diseases in North Carolina
Lindsey Thiessen 2017-2018
https://growingsmallfarms.ces.ncsu.e.. .sen.pdf?fwd=no
• Things learned:
• Potential disease problems for producers in NC
• Good/bad growing conditions for hemp
• Things still unknown:
• Chemical management options
• Can use labeled chemistries under FIFRA 25b list until more added
• Environmental condition impact in 2019
Hemp Pest Spectrum and Potential Relationship between Helicoverpa zea Infestation and Hemp Production in the United States in the Face of Climate Change
Olufemi S. Ajayi and Michelle Samuel-Foo
Insects 2021, 12,940.
DOI: 10.3390/insects12100940
https://www.mdpi.com/2075-4450/12/10/940
Simple Summary: Cultivation of industrial hemp Cannabis sativa in the United States is now being expanded due to the recent legalization of the crop. Multiple insect pests attack the crop. One of the common pests is the corn earworm Helicoverpa zea that causes extensive damage to the marketable parts of hemp. Changing global climate may lead to expansion of the geographic range of insect pests. Thus, growers of this crop in the United States have to face new and intense pest problems now and in the years to come. Here, we assess the potential relationship between corn earworm infestation and hemp production in the US in the face of climate change. We also provide an update on the arthropods associated with hemp cultivation across the US. Climate change can affect aspects of interactions between hemp and corn earworm. Temperature and photoperiod affect the development and diapause process in H. zea. Drought leads to a reduction in hemp growth. Overall, our assessment suggests the selection of varieties resistant to stresses from climate and insects. Host plant diversity may prevent populations of corn earworm from reaching outbreak levels. Ongoing research on effective management of H. zea on hemp is critical.
Abstract: There has been a resurgence in the cultivation of industrial hemp, Cannabis sativa L., in the United States since its recent legalization. This may facilitate increased populations of arthropods associated with the plant. Hemp pests target highly marketable parts of the plant, such as flowers, stalks, and leaves, which ultimately results in a decline in the quality. Industrial hemp can be used for several purposes including production of fiber, grain, and cannabidiol. Thus, proper management of pests is essential to achieve a substantial yield of hemp in the face of climate change. In this review, we provide updates on various arthropods associated with industrial hemp in the United States and examine the potential impact of climate change on corn earworm (CEW) Helicoverpa zea Boddie, a major hemp pest. For example, temperature and photoperiod affect the development and diapause process in CEW. Additionally, drought can lead to a reduction in hemp growth. Host plant diversity of CEW may prevent populations of the pest from reaching outbreak levels. It is suggested that hemp varieties resistant to drought, high soil salinity, cold, heat, humidity, and common pests and diseases should be selected. Ongoing research on effective management of CEW in hemp is critical.
History, Origin, and Diversity of Hop Stunt Disease and Hop Stunt Viroid
T. Sano
Acta horticulturae 1010(1010):87-96 October 2013
DOI: 10.17660/ActaHortic.2013.1010.9
Hop stunt disease first emerged in Japan and reported as “dwarf hop” or “cedar-shaped hop” in the 1940s and the early 1950s. The disease emerged in Korea in 1988 and was confirmed in North America in 2004 and in China in 2007. The diseased plants develop yellowish green leaves and drooped leaf petioles in early to mid-growing season, and results in stunting of main and lateral bines. Depending on hop variety, visual stunting becomes apparent only several years after the infection. More serious is the reduction of the alpha-acid content, which is occasionally accompanied by reduction in the total cone numbers per vine. The alpha-acid content of sensitive cultivars is reduced to less than one half. Viroids are the smallest known pathogens and cause severe to mild diseases in economically important crops. They are single-stranded, circular, and self replicating non-coding RNAs with a size of 250 to 400 nucleotides. Viroid replication is dependent on host transcriptional machinery, and pathogenicity depends entirely on interactions with cellular components of the host. Hop stunt disease (HSD) is caused by the Hop stunt viroid (HpSVd), a member of the Pospiviroidae family. Infection of hops by Apple fruit crinkle viroid also exhibits similar disease symptoms. HpSVd was first discovered from the dwarfed-hop, but soon after, it was found to have infected cultivated grapevines, citrus and stone fruits, including plum, peach, apricot, almond and Jujube. HpSVd is now considered to be a ubiquitous and genetically variable pathogen that has spread among cultivated crops worldwide. Unfortunately, all the HpSVd isolates have a potential to cause hop stunt, and current HSD epidemics in Japan, USA, and China may have originated from inter-specific transmission of HpSVd from cultivated grapevines to hops.
Host-Parasite Relationships in Cannabis
John McPartland, Karl Hillig
October 2005 Journal of Industrial Hemp 10(2):85-104
DOI: 10.1300/J237v10n02_08
Plant taxonomy is primarily based on patterns of morphologicalvariation and geographical distribution. Plant-parasite relationships can also offer clues regarding the phylogeny of the host plant. Many obligate parasites coevolve with their hosts, eventually becoming restricted to an individual taxon. Host restriction may take place at different taxonomic ranks, i.e., parasites may become restricted to one host genus within a plant family, to one species within a genus, or to one infraspecific taxon within a species. This phylogenetic congruence between plants and their parasites may be due to cospeciation or due to co-adaptation (reciprocal adaptive selection). Our study reviewed plantparasite interactions with regard to putative Cannabis taxa. The results suggest that certain parasites may have co-evolved with putative species and biotypes within the Cannabis genus.
Identifying Unknown Microbiological Contaminants in Cannabis
Jack Rudd, Analytical Cannabis
https://www.analyticalcannabis.com/a...annabis-311544
We know microbiological contaminants pose a potential risk to cannabis consumers. In particular, bacteria and fungi may cause opportunistic infections immunocompromised individuals and even dead or dormant organisms may present a threat. As regulations have evolved across the US and Canada, it has become clear that robust, routine microbiological testing is essential in protecting consumer safety for medical patients and recreational users alike. As things stand, a patchwork of different testing regulations mandate a range of testing requirements across the US, and discussions on the best approach to guaranteeing accurate, reliable results are ongoing.
To find out more about the challenges faced and the technology available to the industry, we spoke to Amrita Puri, a Field Marketing Specialist with Bio-Rad, which offers a range of validated molecular- and culture-based
diagnostic tools for the detection of pathogens in cannabis and other products.
Industrial Hemp Crop Diseases What We’ve Seen and What We Know
Shouhua Wang, Ph.D.
State Plant Pathologist Nevada Department of Agriculrure
https://agri.nv.gov/uploadedFiles/ag...203-7-2018.pdf
A plant disease is a result of interaction of three factors:
Host - A susceptible host plant is available
Pathogen - A pathogen is present
Environment - Environmental conditions that favour the host and pathogen to allow disease development
Insecticidal activity and biochemical composition of Citrullus colocynthis, Cannabis indica and Artemisia argyi extracts against cabbage aphid (Brevicoryne brassicae L.).
Ahmed, M., Peiwen, Q., Gu, Z., Liu, Y., Sikandar, A., Hussain, D., Ji, M.
Scientific Reports, 10(1). (2020).
doi:10.1038/s41598-019-57092-5
Plant extracts contain many active compounds, which are tremendously fruitful for plant defence against several insect pests. The prime objectives of the present study were to calculate the extraction yield and to evaluate the leaf extracts of Citrullus colocynthis (L.), Cannabis indica (L.) and Artemisia argyi (L.) against Brevicoryne brassicae and to conduct biochemical analysis by gas chromatography-mass spectrometry (GC-MS). The results suggested that when using ethanol, C. colocynthis produced a high dry yield (12.45%), followed by that of C. indica and A. argyi, which were 12.37% and 10.95%, respectively. The toxicity results showed that A. argyi was toxic to B. brassicae with an LC50 of 3.91mgmL?1 , followed by the toxicity of C. colocynthis and C. indica, exhibiting LC50 values of 6.26 and 10.04mgmL?1 , respectively, which were obtained via a residual assay; with a contact assay, the LC50 values of C. colocynthis, C. indica and A. argyi were 0.22mgmL?1 , 1.96 and 2.87mgmL?1 , respectively. The interaction of plant extracts, concentration and time revealed that the maximum mortality based on a concentration of 20mgL?1 was 55.50%, the time-based mortality was 55% at 72h of exposure, and the treatment-based mortality was 44.13% for A. argyi via the residual assay. On the other hand, the maximum concentration-based mortality was 74.44% at 20mgmL?1 , the time-based mortality was 66.38% after 72h of exposure, and 57.30% treatment-based mortality was aforded by A. argyi via the contact assay. The biochemical analysis presented ten constituents in both the A. argyi and C. colocynthis extracts and twenty in that of C. indica, corresponding to 99.80%, 99.99% and 97% of the total extracts, respectively. Moreover, the detected caryophylleneonides (sesquiterpenes), ?-bisabolol and dronabinol (?9 -THC) from C. indica and erucylamide and octasiloxane hexamethyl from C. colocynthis exhibited insecticidal properties, which might be responsible for aphid mortality. However, A. argyi was evaluated for the frst time against B. brassicae. It was concluded that all the plant extracts possessed signifcant insecticidal properties and could be introduced as botanical insecticides after feld evaluations
IPM for Cannabis Pests
William Quarles
IPM Practitioner, XXXVI (5/6) Published August 2018
https://www.birc.org/IPMPCannabis.pdf
About 35 million people in the U.S. use marijuana on a regular basis. It is the fourth most popular recreational drug after caffeine, alcohol, and tobacco
(Ingraham 2017). Marijuana is legal for medical use in 31 states, and it has been decriminalized in 13 other states. Recreational marijuana is legal for adults in nine states, including Alaska, California, Colorado, Oregon, Maine, Massachusetts, Nevada, Vermont, and Washington. Legalization in Michigan and New Jersey is expected soon. There are only four states where it is totally
illegal according to state law (Wikipedia 2018). Marijuana may be the largest
cash crop in the U.S. with an estimated value of $35.8 billion each year. Its closest rival is soybeans, whose value varies with yields, and recently with tariffs. Hemp also has a lot of economic potential. About $688 million of imported hemp products were sold in the U.S. in 2016 (Strickler 2018). Cultivation of both marijuana and hemp is illegal according to federal law. The federal government lists Cannabis as a Controlled Substances Act Schedule I drug and claims it has no medical value. The federal fate of marijuana is uncertain, but a law legalizing the cultivation of hemp throughout the U.S. was introduced into the U.S. Senate on April 12, 2018 (McConnell
2018).
NOT CANNABIS SPECIFIC
Interactions of insect pheromones and plant semiochemicals
Gadi V.P. Reddy and Angel Guerrero
TRENDS in Plant Science Vol.9 No.5 May 2004
doi:10.1016/j.tplants.2004.03.009
Plant semiochemicals are known to produce a wide range of behavioral responses in insects. Some insects sequester or acquire host plant compounds and use them as sex pheromones or sex pheromone precursors. Other insects produce or release sex pheromones in response to specific host plant cues, and chemicals from host plants often synergistically enhance the response of an insect to sex pheromones. Plant volatiles can also have inhibitory or repellent effects that interrupt insect responses to pheromones and attract predators and parasitoids to the attacking species after herbivory injury. Here, we review different interactions between plant semiochemicals and insect pheromones, paying attention to those that can result in the development of more efficient and reliable programs for pest control
NOT CANNABIS SPECIFIC
Investigation on some biological aspects of Chrysoperla lucasina (Chrysopidae: Neuroptera) on Bemisia tabaci in laboratory conditions
Alinaghi Mirmoayedi
Comm. Appl. Biol. Sci, Ghent University, 77/4, 2012
https://www.researchgate.net/publica...ory_conditions
Bemisia tabaci is one of the most important key pests of many types of cultivated plants. Lacewings (Chrysopidae: Neuroptera) are predatory insects, widely used in biological control programs. Between them green lacewing is a promising biological control agent of pests in green houses and crop fields.
In this study, gravid females of the green lacewing Chrysoperla lucasina (Lacroix) were captured from Sarepolzahab ( altitude 540m, latitude 34°,14´ N 46°,9´ E) in western part of Iran. Collected insects were reared in a growth chamber, under experimental conditions (25±1°C, 70±5% RH and a photoperiod of 16:8 L: D). Different diets were offered to larvae which consisted of a whitefly species B.tabaci, an aphid Myzus persica and also lyophilized powder of drone honeybee (Apis melifera). As different foods were used to nurish larvae, so for each diet, mean larval period were calculated, and finally means were compared to each other. Anova in MSTAT-C was used for analysis of variance, and Duncan multiple range test (DMRT) to compare between means. The results showed that larvae had maximum duration of 27±0.33 days when fed on honeybee lyophilized powder and the minimum value was 17.9±0.3 days for B. tabaci. 25±0.27 day recorded for M. persicae. Food preference of the 3rd instar larvae of green lacewing was surveyed, they showed a food preference to M. persicae, to compare with B. tabaci, as the former has a bigger body size, so more easily to be captured by the predator larvae. The 3rd instar larvae of lacewing were more voracious on preys, than the 1st or the 2nd instar larvae. Statistically speaking, there were a significantly difference when mean of different preys consumed by predator larvae were compared. We found, that when the predator larvae have fed on B.tabaci, their development time was shorter, and when arrived to adult stage, the adults showed, an improved fertility. The results indicated that the suitable prey not only can increase the rate of through accelerating developmental stages of the predator and by means of an increase in its pupal body weight consequently promoting the fecundity of resulting adults, but also can alter predators population density in relation to own production numbers.
Is Irradiation Treatment on Cannabis Too Good to be True
Medicinal Genomics Jan 3 2022
www.medicinalgenomics.com/irradiation-treatment-cannabis/
Isolation of the pathogens causing hemp stem disease
X. He, S. Gang Geng, K. Li, N. Zheng
January 2016
DOI: 10.5013/IJSSST.a.17.29.19
Hemp, with very strong vitality, is a kind of annual tall herbaceous plant. Hemp is naturally hardy and drought tolerant which grows well in a cold climate. Hemp plants can resist various plant diseases. Besides, hemp can fight against insect pests without toxic pesticides and chemical fertilizers and thus effectively improve the soil salinization. In this work, two strains of pathogenic fungi (DN1 and DN2) were isolated from lesion site of the hemp plant, by an observation of hypha and spore morphology, the DN1 and the DN2 are respectively determined as deuteromycotina Alternaria (Alternaria alternata) and Verticillium (M.Verticillium). At pH values between 4 and 14, the two fungi can grow normally and show a great ability to adapt to the environment. Effects of hemp on soil pH were determined by pot experiment. The results showed that hemp could repair the weak alkaline soil.
ISSUES AND MITIGATIONS Hop Latent Viroid
DR. JOHN BRUNSTEIN (SEGRA)
https://mcusercontent.com/205b36c25f...Whitepaper.pdf
Zoom video:
https://us02web.zoom.us/rec/play/5F5...x_zm_rhtaid=19
Large-scale crop loss is every grower’s nightmare, but unfortunately, it is becoming an increasingly common reality. Modern Cannabis pathogens such as Hop Latent Viroid (HLVd) are emerging and accelerating, particularly in California, the most mature cannabis market in the world. While California
has long been an inspiration to the global cannabis community as an established and thriving market, it now also needs to serve as a cautionary tale as global cannabis operators come into contact with a growing list of pathogens causing documented economic losses.
Jahniella bohemica
John McPartland, Karl Hillig
October 2006 Journal of Industrial Hemp 11(2):97-108
DOI: 10.1300/J237v11n02_08
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The fungus Jahniella bohemica damages hemp stalks in Europe. For 125 years this fungus has been confused with Leptosphaeria acuta, a fungus that infests nettle stalks. The morphology of J. bohemica is described in detail, compared to other Jahniella species, and also compared to L. acuta. The nomenclature of L. acuta is revised.
Jahniella bohemica Part II: Mistaken Identity with Septoria cannabis Infesting Hemp Stalks
John McPartland, Karl Hillig
May 2007 Journal of Industrial Hemp 12(1):63-74
DOI: 10.1300/J237v12n01_07
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The fungus Jahniella bohemica damages hemp stalks in
Europe. In the previous issue of “Cannabis Clinic” we illustrated Jahniella bohemica and showed how this fungus has been confused with Leptosphaeria acuta, a fungus that infests nettle stalks. Jahniella bohemica has also been confused with Septoria cannabis, a fungus that usually attacks hemp leaves, but sometimes attacks hemp stalks. We now illustrate differences between these species, using novel methods of microchemistry, and emphasize the signs and symptoms of S. cannabis infestation.
Not Cannabis Specific
Keeping Your Environment Clean: Preventative Measures Against Contamination
By Jeff Scheir
https://cannabisindustryjournal.com/tag/uvc/
For years we have heard about and sometimes experienced, white powdery mildew when growing cannabis. It is a problem we can see, and we have numerous ways to combat it. But now more and more states are introducing regulatory testing on our harvests and they are looking for harmful substances like Escherichia coli., Aspergillis Fumigatus, Aspergillis terreus, … just to name a few. Mycotoxins, mold and bacteria can render a harvest unusable and even unsellable- and you can’t see these problems with the naked eye. How much would it cost you to have to throw away an entire crop?
You bring in equipment to control the humidity. You treat the soil and create just the right amount of light to grow a superior product. You secure and protect the growing, harvesting, drying and production areas of your facility. You do everything you can to secure a superior yield… but do you?
Many of the organisms that can hurt our harvest are being multiplied, concentrated and introduced to the plants by the very equipment we use to control the growing environment. This happens inherently in HVAC equipment.
Kenevir Cannabis sativa L Bitkilerinde Gorulen Virus Kaynakli Hastaliklar
Mehmet Ali Sevik
Türkiye Tarımsal Araştırmalar Dergisi 7 (1) Feb 2020 (in turkish)
DOI: 10.19159/tutad.663715
https://dergipark.org.tr/en/download...le-file/970960
https://www.researchgate.net/publica...=re413_x_i_pbf
Hemp (Cannabis sativa L.) belongs to Cannabis genus in Cannabinaceae family. Industrial hemp (C. sativa var. vulgaris L.), a variant of the C. sativa, is an important industrial crop. Industrial hemp is one of the oldest raw material resource crops know to humans. Hemp is cultivated to produce a vast variety of products such as hemp seeds, hemp oil, clothing, rope, paper, insulation, cosmetics, biodegradable plastics, construction material, resin, fuel, etc. Hemp is very sensitive to environmental conditions, diseases, and pests. Plants are more susceptible to diseases in adverse environmental conditions. More than 100 microorganisms (fungi, bacteria, virus, etc.) can cause disease in cannabis. In many studies conducted; hemp streak virus (HSV), hemp mosaic virus (HMV), alfalfa mosaic virus (AMV), cucumber mosaic virus (CMV) and arabis mosaic virus (ArMV) have been reported to cause diseases in hemp varieties. Also, tobacco mosaic virus (TMV),tobacco ringspot virus (TRSV), tobacco streak virus (TSV), tomato ringspot virus (TomRSV), eunoymous ringspot virus (ERSV), elm mosaic virus (EMV), and foxtail mosaic virus (FMV) are isolated from hemp plants. In recent years, studies on cannabis viruses have reported that beet curly top virus (BCTV) and lettuce chlorosis virus (LCV) infect cannabis plants.
Laboratory Bioassays of Biological/Organic Insecticides to Control Corn Earworm on Hemp in Virginia, 2019
Kadie E. Britt1 and Thomas P. Kuhar
Arthropod Management Tests 45(1) January 2020
DOI: 10.1093/amt/tsaa102
https://www.researchgate.net/publica..._Virginia_2019
Hemp acreage in the United States is increasing and outdoor crops are susceptible to corn earworm (CEW) feeding injury. Two separate bioassays were conducted in fall 2019 to evaluate the effects of biological/ organic insecticide products on CEW in hemp.
Bioassay 1 was initiated on 16 Sep 2019 and included the following treatments: Gemstar (Helicoverpa zea nuclear polyhedrosis virus [HzNPV]), Javelin (Bacillus thuringiensis var. kurstaki), DiPel (Bacillus thuringiensis var. kurstaki), XenTari (Bacillus thuringiensis var. aizawai + kurstaki), Venerate (94.5% Heatkilled Burkholderia spp. strain A396 cells and spent fermentation media), Grandevo (30% Chromobacterium subtsugae strain PRAA4-11 and spent fermentation media), Entrust (Spinosad), and an untreated check (Table 1). Third and fourth instar CEW larvae were collected from ears from an untreated field of sweet corn (Zea mays) established at Virginia Tech’s Kentland Farm in Whitethorne, VA (Kentland). Only vigorous larvae with fresh color were used for the experiment. On 16 Sep 2019, hemp seed heads (‘Felina-32’) were collected from field plots at Kentland, brought to the laboratory, and cut into ~9 cm3 sections. Forty hemp seed head sections were dipped into spray-tank concentrations of each treatment (Table 1) and placed individually into 1 oz plastic diet cups with a single CEW larva. A tray of 10 cups represented a replicate and four replicates were established for each treatment and placed in a different stack on the laboratory bench for the duration of the experiment. Diet cups were placed on the laboratory benchtop and held at laboratory ambient light and temperature (20–25°C) for 96 h and checked daily for mortality. Percent mortality data were analyzed with ANOVA procedures and means separated with Tukey’s HSD.
Bioassay 2 was initiated on 2 Oct 2019 and included the following treatments: Agree (Bacillus thuringiensis var. aizawai), Javelin (Bacillus thuringiensis var. kurstaki), Deliver (Bacillus thuringiensis var. kurstaki), XenTari (Bacillus thuringiensis var. aizawai + kurstaki), Pyganic (pyrethrins), Entrust (spinosad), and an untreated check (Table 2). The experiment was conducted using the same aforementioned procedures except that rather than using fieldcollected CEW, which were depleted from the field, we used third instars raised on artificial diet that were purchased from Benzon Research Inc., Carlisle, PA
Not Cannabis Specific
Mildew control with CleanLight technology
https://cleanlight.nl/wp-content/upl...March-2012.pdf
In September 2010, Horticultural News dedicated a few pages to the introduction of an exciting new crop protection technology in East Africa. It is a technology, not based on chemicals, but based on the use of cleansing light.
Mitochondrial COI Sequence Variations within and among Geographic Samples of the Hemp Pest Psylliodes attenuata from China.
Guo, L., Gao, F., Cheng, Y., Gao, C., Chen, J., Li, Z., … Xu, J.
Insects, 11(6), 370.(2020).
doi:10.3390/insects11060370
The hemp flea beetle Psylliodes attenuata (Coleoptera: Chrysomelidae: Psylliodes) is a common pest of Cannabis sativa, including cultivars of both industrial hemp and medicinal marijuana. Both the larval and adult stages of this beetle can cause significant damages to C. sativa, resulting in substantial crop losses. At present, little is known about the populations of this pest, including its genetic diversity. In this study, we obtained 281 P. attenuata samples from nine field sites representing broad industrial hemp productions in China and analyzed their DNA sequences at the mitochondrial COI gene, the insect DNA barcode. Our analyses revealed a total of 48 haplotypes, with 28 being found only in one specimen each while the remaining 20 were shared by two or more specimens each. Of the 20 shared haplotypes, eight were shared among local populations often from far away locations, consistent with recent long-distance dispersals. However, the observed putative long-distance dispersals have not obscured the significant genetic differentiations among the regional populations from northeastern, eastern, central and southwestern China. Interestingly, haplotype network analyses suggest evidence for potential mitochondrial recombination in natural populations of this species. We briefly discuss the implications of our results on its evolution, center of diversity, route of spread, and pest management strategies in hemp fields.
Not Cannabis specific
Molecular sampling of hop stunt viroid (HSVD) from grapevines in hop production areas in the Czech Republic and hop protection
J. Matousek, L. Orctová, J. Patzak, P. Svoboda, I. Ludvíková
PLANT SOIL ENVIRON., 49, 2003 (4): 168–175
https://www.researchgate.net/publication/264234891
Molecular sampling of HSVd in grapevines in the environs of hop gardens was performed. Specific RT PCR primers were designed to unambiguously distinguish between HLVd and HSVd infections. These primers were used for detection and analysis of HSVd cDNAs from individual samples by thermodynamic methods, TGGE and cDNA heteroduplex analysis. We found that at least 70% of grapevine samples from locations close to hop gardens in Northern Bohemia (atec and Útìk hop production areas) were infected with HSVd forming populations containing quasispecies. Particular sequence variants, dominant in grapevines from wine-growing areas like Znojmo, were also found in minor private vineyards. HSVd was experimentally transmissible (80% success) from these samples to Osvald’s clone 72 of Czech hop, where according to the cDNA library screening, one of the dominant HSVdg variants corresponding to AC E01844 was detected in early populations three weeks p.i. HSVd was detected neither in reproduction materials nor in examined hop gardens. However a potential danger for hop cultivation, consisting in the high biological potential of HSVd spread is discussed.
Kentucky Hemp Disease
Hemp Disease Management 101: Back to Basics
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/diseas...nt-basics.html
Diseases are managed first and foremost by prevention of infection by pathogens*. Once host plants are infected, disease** is not curable. Although some measures can suppress pathogens or slow symptom development, disease cannot be reversed or cured. Thus, it is recommended that preventative measures become priority in every system.
Introduction of diseased plant material into a field or greenhouse puts all healthy plants at risk for infection. Careful selection of plant material and adoption of production guidelines is critical. For example, new plants should remain separated for two to three weeks until they are confirmed to be disease (and insect) free. This period of quarantine helps protect existing healthy plant material.
On occasion, pathogens are introduced to production systems. Immediately upon identification/confirmation, protect healthy plants from infection and spread. Destroy, quarantine, and/or apply chemical treatments to infected plants. Nearby plants should be treated as infected and infective (even if symptoms have not yet developed). All diseased plant material is a threat to healthy plants, and thereby should be removed from production areas. As mentioned previously, disease cannot be cured or eradicated. Elimination of pathogens is only possible by extreme measures (e.g. crop destruction or greenhouse disinfestation).
• Disease101: Hemp Disease Management Basics
• ARTICLES:
• Septoria Leaf Spot
• Leaf Spot Diseases, An Overview
• Gray Mold (Botrytis) in the Greenhouse
• Powdery Mildew of Hemp
• Pythium Root Rot
• Sanitation for Disease Management in Greenhouse Hemp
• Sanitation for Disease Management in Field Hemp
• Cultural Calendar
• KY Hemp Disease
Disease Management Guide to Septoria Leaf Spot in the Field
Dr. Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/septoria-leaf-spot.html
Septoria sp.
Hemp (Cannabis sativa) is grown both outdoors and in greenhouses. Outdoor-grown hemp is susceptible to infection by leaf spot fungi that affect other crops and nearby plants, especially during periods of extensive rain or high humidity. There are three primary leaf spot diseases that affect hemp in Kentucky: Cercospora leaf spot, hemp leaf spot, and Septoria leaf spot. Septoria leaf spot is the most commonly reported of the leaf spot diseases.
Symptoms. Septoria leaf spot causes leaf spotting that can result in leaf loss and reduction of photosynthesis. Under extreme conditions, plants can lose 50% to 90% of leaves. If disease becomes severe early in the season, plant stunting and loss of vigor is possible. Plant death can occur under extreme conditions.
Disease symptoms begin in lower leaves and within the inner canopy where leaf wetness and high humidity occur. Disease begins as small irregularly shaped spots with bright yellow margins. Spots expand to about ¼ inch in diameter and appear brown with a prominent yellow halo. As spots enlarge, brown areas become more irregular and develop gray to white centers. Yellow halos expand outward from spots. Advanced symptoms include coalescence of yellow areas and/or coalescence of brown spots. Entire leaves rapidly become yellow and drop from plants.
Causal Agent. The fungus that causes Septoria leaf spot is a species within the genus Septoria. The precise causal species of Septoria leaf spot in Kentucky is currently under investigation. In general, Septoria spp. infect specific hosts or a specific group of hosts. For example, Septoria leaf spot of tomato causes disease on tomato and other solanaceous plants and Septoria tritici blotch of wheat affects only wheat and grass hosts. Neither of these diseases are caused by the same species that causes disease in hemp.
Septoria leaf spot spreads by spores called conidia. Infective conidia develop within capsule-like structures called pycnidia. Pycnidia appear as dark specks that resemble black pepper flakes in centers of spots; they contain large numbers of conidia. When excess moisture is present, conidia are released from pycnidia in a curling, oozing formation. Conidia move short distances via rain splash and long distances by wind-driven rain. Each conidium is capable of creating a new infection, and these new infections develop into leaf spots within 7-10 days.
Leaf Spot Diseases, An Overview
A Scientific Look at Diseases of Kentucky Hemp
Cercospora Spot
Septora Leaf Spot
Hemp Leaf Spot
https://www.kyhempdisease.com/leaf-s...-overview.html
Disease Management Guide to Gray Mold in the Greenhouse
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/gray-m...reenhouse.html
Botrytis cinerea
Hemp (Cannabis sativa x indica) is grown both outdoors and in greenhouses. High humidity greenhouses and other closed environments are often ideal for fungal diseases such as gray mold. Outdoor-grown hemp is susceptible during periods of high humidity or rain.
Symptoms. Gray mold develops primarily in flower buds and tightly-packed plant parts, and it is recognized by its gray moldy growth. Masses of mycelia (fungal strands) and clusters of conidia (asexual spores that are produced in large numbers) make up the dense gray mats. The fungus is commonly found in and between buds where microclimates are humid and air flow is limited. Severe infections can lead to yield loss as buds and flowers become infected.
While moldy buds are the most common disease phase, stems, petioles, and growing tips can also be affected. Pruning cuts, insect damage, and other openings are ideal for the opportunistic fungus. Once the fungus colonizes, it can girdle stems and cause them to break at the point of infection. Seedling infections and damping off can also result under humid conditions and in greenhouses with high levels of fungal contamination. Damping off in seedlings causes plant collapse.
Causal Agent. The fungus Botrytis cinerea is the causal agent of gray mold. It is ubiquitous, in that it is ever-present. Infection by the Botrytis fungus is dependent upon a wound or opening in plant tissue. Once infection takes place, though, the fungus can move from cell to cell, killing tissue as it spreads.
A single bud can host up to 1 million infective spores as humidity rises above 85%. These spores are carried by air currents to healthy plant material; fans, wind, and mechanical means can move spores, setting off a repeating disease cycle.
Management of Powdery Mildew Begins with Understanding the Causal Fungus
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/powder...w-of-hemp.html
Golovinomyces (synonym Erysiphe sp.)
Hemp (Cannabis sativa x indica) is grown both outdoors and in greenhouses. The environmental conditions of each system varies extensively, resulting in differing disease pressure. High humidity greenhouses and other closed environments are often ideal for fungal diseases such as powdery mildew. Outdoor-grown hemp is much less susceptible to the disease.
Powdery mildew diseases are caused by a group of fungi that develop fungal strands and chains of fungal spores on leaf surfaces and branch tips. Powdery mildew pathogens are host specific; each species of the fungus is specific to certain hosts. Thus, the species that infects Cannabis are restricted to hemp, hops, and a limited number of host plants. Likewise powdery mildew pathogens of surrounding plants (examples dogwood powdery mildew or rose powdery mildew) will not infect Cannabis spp. Golovinomyces sp. (synonym Erysiphe sp.) remains the most common of the powdery mildew pathogens that infect Cannabis spp.
Occurrence of Powdery Mildew Caused by Golovinomyces cichoracearum sensu lato on Cannabis sativa in Canada.
Pépin, N., Punja, Z., & Joly, D. L.
Plant Disease. (2018).
doi:10.1094/pdis-04-18-0586-pdn
Cannabis sativa, a flowering plant belonging to the Cannabaceae family, increasingly is being grown in Canada for medical purposes. As of April 2018, there was 97 authorized licensed producers and more than 200,000 registered clients, making C. sativa an economically important crop in Canada (Government of Canada 2018). Symptoms of powdery mildew were observed on indoor-grown plants in production facilities in Atlantic Canada and British Columbia. Powdery mildew was present in all production sites sampled between 2013 and 2017, and ranged in incidence from 20 to 35%. Symptoms appeared as white circular patches consisting of epiphytic mycelia and conidia on the adaxial leaf surface. As the disease progressed, the mycelia, conidiophores and conidia covered the entire surface of the leaves and spread to flower bracts and buds. The conidiophores were unbranched, cylindrical, measuring 140-260 µm in height and erected singly from mycelium. Conidiophores produced between one and four conidia in chains
Pathogens and Molds Affecting Production and Quality of Cannabis sativa L.
Zamir K. Punja, Danielle Collyer, Cameron Scott, Samantha Lung, Janesse Holmes and Darren Sutton
Frontiers in Plant Science Vol 10, October 2019
doi: 10.3389/fpls.2019.01120
Plant pathogens infecting marijuana (Cannabis sativa L.) plants reduce growth of the crop by affecting the roots, crown, and foliage. In addition, fungi (molds) that colonize the inflorescences (buds) during development or after harvest, and which colonize internal tissues as endophytes, can reduce product quality. The pathogens and molds that affect C. sativa grown hydroponically indoors (in environmentally controlled growth rooms and greenhouses) and field-grown plants were studied over multiple years of sampling. A PCRbased assay using primers for the internal transcribed spacer region (ITS) of ribosomal DNA confirmed identity of the cultures. Root-infecting pathogens included Fusarium oxysporum, Fusarium solani, Fusarium brachygibbosum, Pythium dissotocum, Pythium myriotylum, and Pythium aphanidermatum, which caused root browning, discoloration of the crown and pith tissues, stunting and yellowing of plants, and in some instances, plant death. On the foliage, powdery mildew, caused by Golovinomyces cichoracearum, was the major pathogen observed. On inflorescences, Penicillium bud rot (caused by Penicillium olsonii and Penicillium copticola), Botrytis bud rot (Botrytis cinerea), and Fusarium bud rot (F. solani, F. oxysporum) were present to varying extents. Endophytic fungi present in crown, stem, and petiole tissues included soil-colonizing and cellulolytic fungi, such as species of Chaetomium, Trametes, Trichoderma, Penicillium, and Fusarium. Analysis of air samples in indoor growing environments revealed that species of Penicillium, Cladosporium, Aspergillus, Fusarium, Beauveria, and Trichoderma were present. The latter two species were the result of the application of biocontrol products for control of insects and diseases, respectively. Fungal communities present in unpasteurized coconut (coco) fiber growing medium are potential sources of mold contamination on cannabis plants. Swabs taken from greenhouse-grown and indoor buds pre- and post-harvest revealed the presence of Cladosporium and up to five species of Penicillium, as well as low levels of Alternaria species. Mechanical trimming of buds caused an increase in the frequency of Penicillium species, presumably by providing entry points through wounds or spreading endophytes from pith tissues. Aerial distribution of pathogen inoculum and mold spores and dissemination through vegetative propagation are important methods of spread, and entry through wound sites on roots, stems, and bud tissues facilitates pathogen establishment on cannabis plants.
Pythium Root Rot Control in Seedlings and Cuttings Starts with Prevention
Nicole Gauthier
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/pythium-root-rot.html
Pythium spp.
Industrial hemp (Cannabis sativa x indica) in Kentucky is grown both outdoors and in greenhouses. Under wet soil conditions in either system, Pythium root rot and damping off diseases pose threats to seedlings, cuttings, and young plants. Indoor-grown hemp is most often infected, however.
Pythium root rot and damping off are caused by several species of Pythium, a water mold pathogen. Pythium are soilborne, fungus-like oomycetes. The term water mold is often used because these pathogens require free water in order to complete their life cycles (reproduce and spread from plant to plant). Under wet conditions such as rain or irrigation, propagules (particularly swimming zoospores) increase dramatically, disseminate to healthy roots, and infect. Disease often develops within a week or two after infection.
Root rot and lower stem decay cause above-ground symptoms such as marginal leaf scorch, stunting, poor vigor, and/or inconsistent stands. These symptoms are the result of lack of water and nutrient uptake as root and vascular tissue is damaged. Disease is more severe under wet soil conditions, high soluble salts, and plant stress.
Hemp Field Sanitation for Small-Scale Plantings
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/sanita...ield-hemp.html
IMPORTANCE OF SANITATION
Although hemp is considered a disease-free plant, it is unknown whether levels of certain pathogens can build up to problematic levels. If diseases become a significant problem in field-planted hemp, results can include premature leaf drop, bud decay, dieback, decline, and even plant death. When diseases do occur, it is often presumed that fungicides are the most important and effective disease management tools available. However, there are limited fungicides available for use in hemp. Thus, a good sanitation program can help reduce the need for chemical controls and can improve the effectiveness of other practices for managing disease. This often-overlooked disease management tool reduces pathogen numbers and eliminates infective propagules (inoculum such as fungal spores and survival structures) that cause disease.
For example, certain fungal and water molds can become prevalent during rainy or humid growing seasons. When disease management is neglected, pathogen populations build-up and continue to increase as long as there is susceptible plant tissue available for infection and disease development. Infected plant tissue, infested soil, and pathogen propagules all serve as sources of pathogens that can later infect healthy plants.
Reduction of pathogens by various sanitation practices can reduce both active and dormant pathogens. While actively growing plants can provide host tissue for pathogen multiplication, dead plant material (diseased foliage, stems, and/or roots) can harbor overwintering propagules for months or years. These propagules can travel via air/wind currents, stick to shoes or tools, or move with contaminated soil or water droplets. Thus, prevention of spread of pathogens to healthy plants and the elimination of any disease-causing organisms from one season to another are the foundations for a disease management program using sanitation practices.
Hemp Greenhouse Sanitation
A Scientific Look at Diseases of Kentucky Hemp
https://www.kyhempdisease.com/sanita...ouse-hemp.html
Diseases are a major concern for greenhouse growers and can be a key limitation to profitable plant production. Disease management in greenhouses is critical because the warm, humid environment in these structures provides optimal conditions for reproduction of many pathogens. When disease management is neglected, pathogen populations build-up and continue to increase as long as there is susceptible plant tissue available for infection and disease development. Infected plant tissue, infested soil, and pathogen inoculum (such as spores and survival structures) all serve as sources of pathogens that can later infect healthy plants.
Koppert Pest Control Guidelines
Ask me for info
Larvicidal Action of Cannabidiol Oil and Neem Oil against Three Stored Product Insect Pests: Effect on Survival Time and in Progeny.
Mantzoukas, S., Ntoukas, A., Lagogiannis, I., Kalyvas, N., Eliopoulos, P., & Poulas, K.
Biology, 9(10), 321.(2020).
doi:10.3390/biology9100321
Stored product pests can be detrimental to agricultural produce. As much as chemical pesticides are effective control agents, they involve several environmental and health risks. Within the framework of studies on alternative pest management methods, interest has focused on a plethora of plants whose extracts have demonstrated promising action as insecticides. Azadirachta indica and the derived neem oil have been extensively tested against many harmful insect species. In contrast, Cannabis sativa L. and its main compound, CBD, a highly concentrated cannabinoid, have not been investigated much. The present study examined the potential insecticidal activity of CBD and neem oils against 4th instar larvae of Tribolium confusum, Oryzaephilus surinamensis and Plodia interpunctella on wheat, rice and corn seeds. Treatment efficacy was expressed in terms of larval mortality. Mortality was observed in relation to dosage, time exposure intervals and product types. The results showed clear pesticidal activity for both oils, which at high doses induced significant mortality. The treatments produced significantly fewer offspring in the insect species tested than the control. The efficacy of treatment in progeny suppression was, as expected, dose dependent.
LEGAL PEST MANAGEMENT PRACTICES FOR CANNABIS GROWERS IN CALIFORNIA
Department of Pesticide Regulation
https://www.cdpr.ca.gov/docs/county/...attach1502.pdf
PESTS OF CANNABIS IN CALIFORNIA
Cannabis pests vary according to cultivar (variety), whether the plants are grown indoors or outdoors, and where the plants are grown geographically. The pests included in this review are preliminary and based on the following sources: a presentation given in 2013 by
Whitney Cranshaw, an extension entomologist at Colorado State University, and a review article by John M. McPartland, a professor of family medicine at the University of Vermont. We also received input from Kevin Hoffman, Primary State Entomologist, California
Department of Food & Agriculture (CDFA).
Lettuce Chlorosis Virus Disease: A New Threat to Cannabis Production
August 2019 Viruses 11(9):802
DOI: 10.3390/v11090802
Lab: Aviv Dombrovsky's Lab
Hadad, Neta Luria, Smith, Aviv Dombrovsky
In a survey conducted in Cannabis sativa L. (cannabis) authorized farms in Israel, plants showed disease symptoms characteristic of nutrition deprivation. Interveinal chlorosis, brittleness, and occasional necrosis were observed in older leaves. Next generation sequencing analysis of RNA extracted from symptomatic leaves revealed the presence of lettuce chlorosis virus (LCV), a crinivirus that belongs to the Closteroviridae family. The complete viral genome sequence was obtained using RT-PCR and Rapid Amplification of cDNA Ends (RACE) PCR followed by Sanger sequencing. The two LCV RNA genome segments shared 85–99% nucleotide sequence identity with LCV isolates from GenBank database. The whitefly Bemisia tabaci Middle Eastern Asia Minor1 (MEAM1) biotype transmitted the disease from symptomatic cannabis plants to un-infected ‘healthy’ cannabis, Lactuca sativa, and Catharanthus roseus plants. Shoots from symptomatic cannabis plants, used for plant propagation, constituted a primary inoculum of the disease. To the best of our knowledge, this is the first report of cannabis plant disease caused by LCV.
Longhorn Beetles and Botryosphaeria
John McPartland, Karl Hillig
November 2007 Journal of Industrial Hemp 12(2):123-133
DOI: 10.1300/J237v12n02_09
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. The hemp longhorn beetle (Thyestilla gebleri) damages
hemp stalks in eastern Asia. The fungus Botryosphaeria marconii causes stalk and twig blight disease of hemp in North America and perhaps western Europe. The life cycles of the beetle and fungus overlap on host plants; if their geographic ranges also overlapped they would likely cause synergistic damage–an epidemic waiting to happen?
Marijuana (Cannabis sativa) toxicosis in cattle
David Driemeier
Veterinary and human toxicology · January 1998
4 of 5 cattle died after consuming bales of dried marijuana leaves.
https://www.researchgate.net/publica...osis_in_cattle
Microbial Contaminants in Cannabis: What are the Dangers?
Reginald Gaudino, Steep Hill July 13, 2018
https://800ezmicro.com/cannabis-test...e-dangers.html
Unless cannabis is grown in a clean room with appropriate air ?ltration and other good growing and laboratory practices, it is inevitable that these microorganisms will be found on cannabis ?owers and products made with them. Most microorganisms do not present a problem at low levels, though some pathogenic microorganisms are harmful even at low levels because they produce toxins that cause a variety of symptoms: from allergy-like symptoms to various types of cancer.
Other microorganisms are harmful at mid to higher levels of contamination, particularly if they are inhaled. Immunocompromised patients including those receiving chemotherapy are at a higher level of risk to all microorganisms, where even low levels of microbial contamination can lead to fatality. Contaminated medical cannabis and incidence of diseases such as Aspergillus nodulosis (a disease caused by the inhalation of Aspergillus niger) has already been noted (1).
Microbiological examination of nonsterile Cannabis products: Molecular Microbial Enumeration Tests and the limitation of Colony Forming Units.
Kevin McKernan, Yvonne Helbert, Heather Ebling, Adam Cox, Liam T. Kane, Lei Zhang
https://osf.io/vpxe5/download
Cannabis microbial testing presents unique challenges. Unlike food testing, cannabis testing has to consider various routes of administration beyond just oral administration. Cannabis flowers produce high concentrations of antimicrobial cannabinoids and terpenoids and thus represent a different matrix than traditional foods. In 2018, it is estimated that 50% of cannabis is consumed via vaporizing or smoking oils and flowers while the other half is consumed in Marijuana Infused Products or MIPs. There are also transdermal patches, salves and suppositories that all present different microbial considerations. Several recent publications have surveyed cannabis flower microbiological communities. These have detected several concerning genus and species such as Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Penicillium paxilli and Penicillium citrinum, Clostridium botulinum, Eschericia coli, Salmonella and Staphyloccus. There are several documented cannabis complications and even fatalities due to Aspergillosis in immuno-compromised patients. A recent paper even demonstrates a case of cannabis derived Aspergillosis in an immune competent patient.
Microbiological Safety Testing of Cannabis
Cannabis Safety Institute May 2015
Mowgli Holmes, Jatin M. Vyas, William Steinbach, John McPartland
https://cannabissafetyinstitute.org/...f-Cannabis.pdf
Cannabis is increasingly becoming legal at the state level in the U.S., for either medical or recreational use. Each of these states has had to wrestle with the question of how to ensure the safety of a new product that is not covered under any existing safety guidelines. Safety testing in other agricultural industries is regulated by the FDA, the USDA, or by other federal agencies, all of which have been unable to assist the states in this case. The few states that have produced safety testing guidelines for Cannabis were forced to develop them from scratch, without the regulatory and scientific support that federal agencies typically provide. In the absence of this federal guidance, regulators in each state have turned to different sources for information, and each state has produced a unique set of rules and regulations (if they have produced one at all). Many of these are in outright conflict with each other, and they are largely not grounded on scientific research. This whitepaper is focused entirely on the question of microbiological safety, and has been written in order to promote the adoption of regulatory guidelines for the Cannabis industry that are rational, consistent, and safe. We have gathered what data there are on this issue and related ones, and assembled a broad collection of experts on the general subjects of plant microbiology, medical microbiology, and safety-testing of agricultural and food products.
Microbiological study and quantification cannabinoids cannabis samples catalonia cscs
Fundación CANNA
https://www.fundacion-canna.es/en/mi...catalonia-cscs
In 2014, Fundación CANNA has carried out a study in which 55 Cannabis samples from 31 social Cannabis clubs from Catalonia were analysed. The aim was to learn about microorganisms that could appear and give information about the average potency of the Cannabis dispensed. The results were shown in the scientific park of the University of Catalonia in October.
Microbiological study of Cannabis samples
Fundación CANNA
https://www.fundacion-canna.es/en/mi...nnabis-samples
Cannabis, like any other plant or food, can contain microbiological contaminants potentially harmful for our health. These contaminants are some types of bacteria and fungi that could end up appearing or developing in the final product. It will depend on the growing, drying, processing, preservation and handling of the plant.
Samples from several clubs from Cataluña were analysed in the laboratory. A total of 55 samples from 31 CSC.
In order to determine the microbiological level of the samples analysed, two factors have been taken into account: the total number of microorganisms present in each sample, and the absence of microorganisms with high pathogenic potential. A high number of microorganisms, irrespective of the kind of microorganism, indicates that the production, preservation and/or handling processes haven't been properly managed. Nowadays, some US states are establishing microbiological limits for the Cannabis provided in their dispensaries.
Microbiological Testing of Cannabis and Derived Products
Microbiology International
https://800ezmicro.com/cannabis-testing.html
Cannabis samples are typically received in the testing laboratory as the flower, topical emulsions & concentrated oils, or edible preparations.
Weighing and Diluting Flower and edibles are processed at a dilution factor of 1:9 or 1:99. Topical emulsions and oils are processed at a ratio of 1:99 or 1:9 with the addition of a surfactant/detergent.
Sample enrichment: Take the guesswork out of weighing and diluting by pairing the EZ-Flow gravimetric diluter and MediaBox ready-to-use sterile broths. Based on the weight of your sample, the EZ-Flow will automatically create the correct dilution factor by drawing liquid media directly from MediaBox and dispensing it into your sample bag. MediaBox connects directly to the EZ-Flow diluter for a completely closed system. The EZ-Flow has a dilution range factor from 1/2 to 1/99. Enrichment broth types: Buffered Peptone Water (BPW), Butterfields Phosphate Buffer, Tryptic Soy Broth with Casamino acids and 8mg/L Novobiocin (mTSB+n), Nutrient Broth, Letheen Broth with Tween 80, and 0.1% BPW. Custom formulations available.
Not Cannabis Specific
Mildew control with CleanLight technology
https://cleanlight.nl/wp-content/upl...March-2012.pdf
In September 2010, Horticultural News dedicated a few pages to the introduction of an exciting new crop protection technology in East Africa. It is a technology, not based on chemicals, but based on the use of cleansing light.
Mitochondrial COI Sequence Variations within and among Geographic Samples of the Hemp Pest Psylliodes attenuata from China.
Guo, L., Gao, F., Cheng, Y., Gao, C., Chen, J., Li, Z., … Xu, J.
Insects, 11(6), 370.(2020).
doi:10.3390/insects11060370
The hemp flea beetle Psylliodes attenuata (Coleoptera: Chrysomelidae: Psylliodes) is a common pest of Cannabis sativa, including cultivars of both industrial hemp and medicinal marijuana. Both the larval and adult stages of this beetle can cause significant damages to C. sativa, resulting in substantial crop losses. At present, little is known about the populations of this pest, including its genetic diversity. In this study, we obtained 281 P. attenuata samples from nine field sites representing broad industrial hemp productions in China and analyzed their DNA sequences at the mitochondrial COI gene, the insect DNA barcode. Our analyses revealed a total of 48 haplotypes, with 28 being found only in one specimen each while the remaining 20 were shared by two or more specimens each. Of the 20 shared haplotypes, eight were shared among local populations often from far away locations, consistent with recent long-distance dispersals. However, the observed putative long-distance dispersals have not obscured the significant genetic differentiations among the regional populations from northeastern, eastern, central and southwestern China. Interestingly, haplotype network analyses suggest evidence for potential mitochondrial recombination in natural populations of this species. We briefly discuss the implications of our results on its evolution, center of diversity, route of spread, and pest management strategies in hemp fields.
Molecular characterization of Aster yellows (16SrI) group phytoplasma infecting Cannabis sativa in eastern Uttar Pradesh
SMRITI MALLÅ, G.P. RAO and P.P. UPADHYAYA
Indian Phytopath. 64 (1) : 75-77 (2011)
During survey of diseases of weeds in and around agricultural fields in eastern UP in 2008, non-specific yellowing, chlorosis of leaves, proliferation of axillary shoots and witches’-broom symptoms on Cannabis sativa plants followed by death of entire plants were recorded. Suspected infected and healthy tissues of C. sativa from different locations at Gorakhpur in eastern UP, India, were examined by nested PCR assay using universal phytoplasma primers P1/P6 and R16F2n/R16R2. C. sativa plant with non-specific yellowing and witches’-broom symptoms yielded phytoplasma-exclusive DNA bands of 1.2 kb when nested PCR was performed. BLAST search analysis of the 16S rRNA sequence of the C. sativa phytoplasma shared 99%
identity with those of phytoplasma members of 16SrI group, ‘Candidatus Phytoplasma asteris’. Therefore, the C. sativa phytoplasma under present study was identified as a member of the 16SrI group.
Molecular characterization, vector identification and sources of phytoplasmas associated with brinjal little leaf disease in India
Manish Kumar, Madhupriya, Govind Pratap Rao,
3 Biotech (2017) 7:7
DOI 10.1007/s13205-017-0616-x
Brinjal little leaf (BLL) is a widespread disease of phytoplasma etiology in India that induces severe economic losses. Surveys were conducted in eight brinjalgrowing states of India during July 2014 to September 2015 and eighteen BLL samples showing little leaf, phyllody and witches’ broom symptoms were collected for phytoplasma identification. Presence of phytoplasmas was confirmed in all the eighteen BLL samples using polymerase chain reaction with phytoplasma-specific primer pairs (P1/P6, R16F2n/R16R2). Pair wise sequence comparison and phylogenetic relationship of 16S rRNA gene sequences of BLL phytoplasma strains confirmed that sixteen out of eighteen BLL strains belonged to clover proliferation phytoplasma (16SrVI) group and two BLL strains (GKP-A and GKP-B) from Gorakhpur, Uttar Pradesh, were classified under 16SrII group. Further virtual RFLP analysis of 16S rDNA sequences allowed finer classification of BLL strains into 16SrII-D and 16SrVI-D subgroups. BLL phytoplasma strains belonging to 16SrVID subgroup were found as the most widespread phytoplasma strains associated with BLL disease in India. 16SrVI-D subgroup phytoplasma association with two symptomatic weed species viz. Cannabis sativa subsp. sativa at Noida, Uttar Pradesh and Portulaca oleracea at IARI fields, New Delhi was also confirmed by nested PCR assays with similar set of phytoplasma-specific primers, pairwise 16S rDNA sequence comparison, phylogeny and virtual RFLP analysis. Out of five identified leafhopper species from BLL-infected fields at Noida, Uttar Pradesh and Delhi, only Hishimonas phycitis was identified as carrier and natural vector of 16SrVI-D subgroup of phytoplasmas by nested PCR assays, sequence comparison, phylogeny, virtual RFLP analysis and transmission assays.
NOT CANNABIS SPECIFIC but many of the viruses are found in cannabis
Molecular variation of viruses infecting hops in Australia and associated studies
October 2010
Damian R CrowleDamian R Crowle
https://www.researchgate.net/publica...ciated_studies
The objectives of this study were to investigate the virus incidence and molecular variation of Apple mosaic virus (ApMV), Hop mosaic virus (HpMV) and Hop latent virus (HpLV) and to examine the Hop latent viroid (HLVd) infection status of Australian hop varieties.
HLVd was found to be ubiquitous in all hop gardens surveyed. This was the first survey of HLVd in Australia. This confirms findings in the Czech Republic where infection was also found to be ubiquitous, while viroid status in other countries also indicates high levels of infection.
A virus survey, primarily to collect viruses for use in molecular analysis, was conducted. The percentage of infected plants detected in this study correlates with those previously undertaken by Pethybridge et al., 2000b. Cultivar ‘Victoria’ had the greatest level of ilarvirus infections (61%) significantly more than ‘Super Pride’ (6%). Cultivar Opal had the greatest incidence of carlavirus infections (38%) but this was not significantly different to other cultivars sampled. Hops from the farm at Bushy Park recorded the highest incidences of Ilarvirus infection (44%) although this was not significantly different to the other sampled farms. However, hops sampled from the Gunns Plains farm showed significantly more carlavirus infections (40%) than the other three sampled farms. Experiments testing transmission capacity of local aphid species (Macrosiphum euphorbiae and Myzus persicae) of the carlaviruses HpMV and HpLV was performed. It was found that both aphid species transmitted both carlaviruses, this being the first study to demonstrate transmission of HpLV by an aphid other than the hop aphid, Phorodon humuli. This study also showed that prior infection by either virus did not significantly affect subsequent the efficiency of transmission of the other which may have explained observations of greater than expected coinfection of both carlaviruses within the field. It was known that two serologically distinct ilarvirus strains infect hop. Prior literature indicated that these were strains of Prunus necrotic ringspot virus (PNRSV) designated –intermediate (PNRSV-I) type and PNRSV-A (apple serotype). This study undertook molecular analysis of hop-infecting ilarviruses to clarify strain diversity and taxonomic relationships. Analyses showed Australian hops are infected with two distinct strains of ApMV (and not PNRSV) these being distinct to ApMV strain commonly found in Apple. It was proposed that hop infecting strains of ilarvirus be termed ApMV-Hop (the former PNRSV-apple serotype) and ApMV-Intermediate (the former PNRSV intermediate serotype). PCR based assays were developed that could be used to distinguish the two strain types.
Suggestions of strains of HpMV had been described due to lethal and non-lethal response following infection in ‘English Golding’ hops. Molecular analysis of HpMV from Australian hop gardens indicated that there were at least two distinct clades of HpMV present with approximately 80% homology. Further work conducted at the conclusion of this study identified a possible third clade of HpMV. All HpLV isolates that were sequenced in this study had a high degree of identity. This was supported by recent publication of several further sequences on GenBank that also show this high degree of identity.
Multiplex qPCR and Cannabis Microbiome sequencing reveals several Bacteria and Fungi Native to Cannabis flowers
Kevin McKernan, Jessica Spangler, Lei Zhang, Vasisht Tadigotla, Yvonne Helbert, Douglas Smith
Color Poster:
https://system.na3.netsuite.com/core...7c1f3&_xt=.pdf
PDF:
https://www.medicinalgenomics.com/wp...owers_sbmt.pdf
New Hemp Diseases and Pests in New Zealand
John McPartland, Birgit Rhode
June 2005 Journal of Industrial Hemp 10(1):99-108
DOI: 10.1300/J237v10n01_08
This article continues the “Cannabis clinic” series, presenting diseases and pests of hemp (Cannabis sativa L.), featuring color illustrations of signs and symptoms. Hemp cultivation is new to New Zealand (NZ). Field trials began in 2001, evaluating cultivars from Europe or North America. Novel crop plants imported into new geographical areas are exposed to new diseases and pests. The imported plants often present less resistance to local problems than do indigenous plants. Many ‘local’ problems in NZ, however, are introduced organisms. Non-native birds cause the greatest crop damage. Rabbits, famous aliens in NZ, also cause problems. Invertebrate pests include the brown garden snail (Helix aspersa), brown field slug (Deroceras panormitanum), orange-soled slug (Arion distinctus), budworm (Helicoverpa armigera), passion vine leaf hopper (Scolypopa australis), caterpillars (Epiphyas postvittana), and melon aphid (Aphis gossypii). The latter species may be the vector of an unidentified virus that infests hemp. In humid regions and wet conditions, the fungi Botrytis cinerea, Trichothecium roseum, and Sclerotinia sclerotiorum rot flowering tops and stalks. For this article, image capture of invertebrate pests and fungi utilized Auto Montage software, to improve the depth of field and produce perfectly focused images.
New species, combinations, host associations and location records of fungi associated with hemp (Cannabis sativa)
July 1997 Mycological Research 101(7):853-857
DOI: 10.1017/S0953756297003584
John McPartland, Marc A. Cubeta
Micropeltopsis cannabis sp. nov. and Orbilia luteola (Roum.) comb. nov. are proposed. New Cannabis host associations include binucleate Rhizoctonia spp., Curvularia cymbopogonis, Sphaerotheca macularis, Glomus mosseae, and Pestalotiopsis sp. The geographic ranges of Pseudoperonspora cannabina, Septoria neocannabina and Fusarium graminearum are expanded.
Not the one, but the only one: about Cannabis cryptic virus in plants showing “hemp streak” disease symptoms.
Righetti, L., Paris, R., Ratti, C., Calassanzio, M., Onofri, C., Calzolari, D., … Grassi, G.
European Journal of Plant Pathology, 150(3), 575–588. (2017).
doi:10.1007/s10658-017-1301-y
Interveinal chlorosis and leaf margin wrinkling are widespread symptoms of Cannabis sativa. They are traditionally attributed to the so-called hemp streak virus (HSV), but its existence has not been demonstrated yet. To our knowledge, no molecular investigation has so far been performed in order to identify the causal agent of this symptomatology, we therefore decided to use traditional and molecular virology techniques to better characterize symptoms and pursue the etiological agent. No pathogenic virus was found by using targeted PCR reactions and by RNA sequencing, whereas we were able to detect the Cannabis cryptic virus (CanCV) with both techniques. We, therefore, developed an RT-qPCR assay based on a CanCVspecific TaqMan probe and applied it to a wide range of symptomatic and symptomless plants, using a twostep (for quantification), or a one-step (for fast detection) protocol. Both symptoms and the virus were only shown to be transmitted vertically and did not pass via mechanical inoculation or grafting, though we could not find any cause-effect correlation between them. In fact, the virus was found in all the tested hemp samples, and its abundance varied greatly between different accessions and individuals, independently from the presence and severity of symptoms. The suggestion that hemp streak is caused by a virus is therefore questioned. Some abiotic stresses seem to play a role in triggering the symptoms but this aspect needs further investigation. For breeding purposes, a selection of parental plants based on the absence of symptoms proved to be efficient in containment of the disease.
Pathogens and Molds Affecting Production and Quality of Cannabis sativa L.
Zamir K. Punja, Danielle Collyer, Cameron Scott, Samantha Lung, Janesse Holmes and Darren Sutton
Frontiers in Plant Science Vol 10, October 2019
doi: 10.3389/fpls.2019.01120
Plant pathogens infecting marijuana (Cannabis sativa L.) plants reduce growth of the crop by affecting the roots, crown, and foliage. In addition, fungi (molds) that colonize the inflorescences (buds) during development or after harvest, and which colonize internal tissues as endophytes, can reduce product quality. The pathogens and molds that affect C. sativa grown hydroponically indoors (in environmentally controlled growth rooms and greenhouses) and field-grown plants were studied over multiple years of sampling. A PCRbased assay using primers for the internal transcribed spacer region (ITS) of ribosomal DNA confirmed identity of the cultures. Root-infecting pathogens included Fusarium oxysporum, Fusarium solani, Fusarium brachygibbosum, Pythium dissotocum, Pythium myriotylum, and Pythium aphanidermatum, which caused root browning, discoloration of the crown and pith tissues, stunting and yellowing of plants, and in some instances, plant death. On the foliage, powdery mildew, caused by Golovinomyces cichoracearum, was the major pathogen observed. On inflorescences, Penicillium bud rot (caused by Penicillium olsonii and Penicillium copticola), Botrytis bud rot (Botrytis cinerea), and Fusarium bud rot (F. solani, F. oxysporum) were present to varying extents. Endophytic fungi present in crown, stem, and petiole tissues included soil-colonizing and cellulolytic fungi, such as species of Chaetomium, Trametes, Trichoderma, Penicillium, and Fusarium. Analysis of air samples in indoor growing environments revealed that species of Penicillium, Cladosporium, Aspergillus, Fusarium, Beauveria, and Trichoderma were present. The latter two species were the result of the application of biocontrol products for control of insects and diseases, respectively. Fungal communities present in unpasteurized coconut (coco) fiber growing medium are potential sources of mold contamination on cannabis plants. Swabs taken from greenhouse-grown and indoor buds pre- and post-harvest revealed the presence of Cladosporium and up to five species of Penicillium, as well as low levels of Alternaria species. Mechanical trimming of buds caused an increase in the frequency of Penicillium species, presumably by providing entry points through wounds or spreading endophytes from pith tissues. Aerial distribution of pathogen inoculum and mold spores and dissemination through vegetative propagation are important methods of spread, and entry through wound sites on roots, stems, and bud tissues facilitates pathogen establishment on cannabis plants.
PATS Indoor Drone Solutions
Pulone Sabina, Terpenes and Testing Magazine
https://terpenesandtesting.com/pats-...one-solutions/
Pests control in crops can be a laborious and difficult task, often involving the use of chemicals which can leave residues in the final product. Pesticides are a great concern on human health due to their toxic nature, persistency, lipophilicity, and bioaccumulation. Monitoring insect populations can help reducing the quantities of pesticide treatments and limiting the concentrations of harmful chemicals. What if we exploit modern technology to keep track of insect offspring and to mechanically eliminate harmful insect species?
PATS Indoor Drone Solutions offers an innovative method to control insect spreading and to selectively get rid of flying pests. By using drones, the monitoring and prevention of harmful species in crops is less time consuming than employees scouting activities. Additionally, tracking pest populations can be more accurate, leading to less pesticide treatments or avoiding them all together by eradicating harmful pests with the drone itself.
Pesticide Use on Cannabis
RodgerVoelker, Mowgli Holmes
Cannabis Safety Institute June 2015
https://cannabissafetyinstitute.org/...hite-Paper.pdf
Legalized cannabis production is a rapidly growing agricultural industry. However, given that cannabis production has developed and operated in an Unregulated setting various practices have been adopted that are at odds with accepted regulations regarding human safety and environmental impacts. Chief amongst these is the unregulated use of pesticides, which has potentially serious public health and environmental consequences. In the absence of guidance from the Environmental Protection Agency on this subject, it is critical that state regulators enact programs to protect workers, the environment, and Cannabis consumers. This paper presents data indicating that pesticide use is widespread in the Cannabis Industry, and that pesticide residue on retail Cannabis products is often found at levels exceeding the allowable levels on any agricultural product. In addition, a set of basic recommendations is presented that will allow states to move forward safely until more detailed Cannabis-°©?specific pesticide data is a
Phorodon cannabis Passerini (Hemiptera: Aphididae), a newly recognized pest in North America found on industrial hemp
Whitney S. Cranshaw, Susan Halbert, Colin Favret, Gary L. Miller,
September 2018 Insecta Mundi 662:1-12
https://theowl.fsu.edu/mundi/article/view/0662/102363
Phorodon cannabis Passerini (Hemiptera: Aphididae: Macrosiphini) is reported for the first time as a pest of Cannabis L. crops in North America. The insect has been confirmed from fields of industrial hemp in Colorado and Virginia and has been found present within greenhouses in at least several American states and one Canadian province. The generic position of the aphid species is discussed and other known members of the genus are ruled out. Phorodon cannabis is placed in genus Phorodon Passerini and subgenus (Diphorodon Börner). Phorodon persifoliae Shinji is transferred to Hyalopterus Koch as a nomen dubium.
Plant-feeding phlebotomine sand flies, vectors of leishmaniasis, prefer Cannabis sativa
Ibrahim Abbasia, Artur Trancoso Lopo de Queirozb, Oscar David Kirsteina, Abdelmajeed Nasereddinc, Ben Zion Horwitza, Asrat Hailud, Ikram Salahe, Tiago Feitosa Motab, Deborah Bittencourt Mothé Fragab, Patricia Sampaio Tavares Verasb, David Pochef, Richard Pochef, Aidyn Yeszhanovg, Cláudia Brodskynb, Zaria Torres-Pochef, and Alon Warburg
PNAS | November 13, 2018 | vol. 115 | no. 46, 11790–11795
DOI: 10.1073/pnas.1810435115
Blood-sucking phlebotomine sand flies (Diptera: Psychodidae) transmit leishmaniasis as well as arboviral diseases and bartonellosis. Sand fly females become infected with Leishmania parasites and
transmit them while imbibing vertebrates’ blood, required as a source of protein for maturation of eggs. In addition, both females and males consume plant-derived sugar meals as a source of energy. Plant meals may comprise sugary solutions such as nectar or honeydew (secreted by plant-sucking homopteran insects), as well as phloem sap that sand flies obtain by piercing leaves and stems with their needle-like mouthparts. Hence, the structure of plant communities can influence the distribution and epidemiology of leishmaniasis. We designed a nextgeneration sequencing (NGS)–based assay for determining the source of sand fly plant meals, based upon the chloroplast DNA gene ribulose bisphosphate carboxylase large chain (rbcL). Here, we report on the predilection of several sand fly species, vectors of leishmaniasis in different parts of the world, for feeding on Cannabis sativa. We infer this preference based on the substantial percentage of sand flies that had fed on C. sativa plants despite the apparent “absence” of these plants from most of the field sites. We discuss the conceivable implications of the affinity of sand flies for C. sativa on their vectorial
capacity for Leishmania and the putative exploitation of their attraction to C. sativa for the control of sand fly-borne diseases
NOT CANNABIS SPECIFIC
Points to Consider in Prevention of Crown Gall
Janine Hasey, Daniel A. Kluepfel & Lani Yakabe
https://www.sacvalleyorchards.com/wa...ng-crown-gall/
Pre-plant fumigation
Long-term Agrobacterium survival
Contaminated grafting tools and graft wood
Host Resistance
Overall Prevention Strategy
These Crown Gall management “Points to Consider” are based on experimental laboratory, greenhouse and /or field research and observations. For answers to your crown gall prevention questions, consult your local UCCE Farm Advisor.
Pseudomonas cannabina pv. cannabina pv. nov., and Pseudomonas cannabina pv. alisalensis (Cintas Koike and Bull, 2000) comb. nov., are members of the emended species Pseudomonas cannabina (ex ?Sutic? & Dowson1959) Gardan, Shafik, Belouin,Brosch, Grimont & Grimont 1999
Carolee T. Bull, Charles Manceau, John Lydon, Hyesuk Kong, Boris A.Vinatzer, Marion Fischer-LeSaux
Systematic and Applied Microbiology 33 (2010) 105–115
doi:10.1016/j.syapm.2010.02.001
Sequence similarity in the 16S rDNA gene confirmed that crucifer pathogen Pseudomonas syringae pv. alisalensis belongs to P. syringae sensu lato. In reciprocal DNA/DNA hybridization experiments, DNA relatedness was high (69–100%) between P. syringae pv. alisalensis strains and the type strain of P. cannabina (genomospecies 9). In contrast, DNA relatedness was low (below 48%) between P. syringae pv. alisalensis and reference strains from the remaining genomospecies of P. syringae including the type strain of P. syringae and reference strain of genomospecies 3 (P. syringae pv. tomato) although the wellknown crucifer pathogen, P. syringae pv. maculicola, also belongs to genomospecies 3. Additional evidence that P. syringae pv. alisalensis belongs to P. cannabina was sequence similarity in five gene fragments used in multilocus sequence typing, as well as similar rep-PCR patterns when using the BOXA1R primers. The description of P. cannabina has been emended to include P. syringae pv. alisalensis. Host range testing demonstrated that P. syringae pv. alisalensis strains, originally isolated from broccoli, broccoli raab or arugula, were not pathogenic on Cannabis sativa (family Cannabinaceae). Additionally, P. cannabina strains, originally isolated from the C. sativa were not pathogenic on broccoli raab or oat while P. syringae pv. alisalensis strains were pathogenic on these hosts. Distinct host ranges for these two groups indicate that P. cannabina emend. consists of at least two distinct pathovars, P. cannabina pv. cannabina pv. nov., and P. cannabina pv. alisalensis comb. nov. Pseudomonas syringae pv. maculicola strain CFBP 1637 is a member of P. cannabina
PYTHIUM APHANIDERMATUM CROWN ROT OF INDUSTRIAL HEMP
Jennifer Schoener, Russ Wilhelm and Shouhua Wang,
NPDN News Volume 12 Issue 9 2
https://www.npdn.org/system/files/NPDN_September-17.pdf
Cultivation of industrial hemp (Cannabis sativa) was first approved in 2014 for the purpose of research and development. The Federal Farm Bill Section 7606 authorizes state agencies to conduct pilot trials on the crop to assess crop viability for the creation of an industry in prospective states. In Nevada, the Department of Agriculture authorizes the production of hemp crops for research purposes. The acreage of hemp production in Nevada is relatively small in comparison to the acreage in other states. However, plant diseases associated with hemp crops have been occurring in Nevada in recent years. In 2016, the Nevada Department of Agriculture Plant Pathology Lab detected Fusarium root rot and sudden death disease from an industrial hemp crop, and Fusarium wilt from medical marijuana plants. Here we describe a newly detected hemp disease: Pythium aphanidermatum crown rot. Pythium aphanidermatum crown rot occurred in a commercial hemp field, with approximately 5-10 percent of plants affected. Infected plants were noticed by leaf yellowing, curling, necrosis, and the eventual death of entire plants (Fig A). White-colored mold (Pythium mycelium) growth on the surface of the crown area was frequently observed when the plant was pulled from the ground (Fig D). Close examination of the stalk revealed extensive water-soaked lesions and cankers around the crown and basal stalk regions (Fig C). With disease progression, the majority of stalks became completely necrotic or rotted (Fig F). Some affected plants had mild root rot. In the early stage of the disease, only mild internal discoloration of the basal stalk tissue was observed (Fig B). In later stages, cankers spread from the crown area to lower branched stems (Fig E). Affected tissue plated on potato dextrose agar (PDA) medium amended with streptomycin did not yield growth of any pathogens. On selective PARP medium, a fast-growing Pythium was obtained from all pieces of stem tissue plated. This isolate grew into a full plate (100mm diameter) on PDA medium within 24 hours at 22 ºC in the dark (Fig G), and produced oogonia, antheridia, and sporangia on corn meal agar (CMA) medium. Based on both morphology and the DNA sequence of the ITS region of rDNA , the isolate was identified as P. aphanidermatum. This disease can be detected using Agdia’s Phytophthora immunoStrip as it cross reacts with Pythium aphanidermatum. Hemp crown and root rot caused by Pythium aphanidermatum was recently reported in Indiana in June, 2017 (https://doi.org/10.1094/PDIS-09-16-1249- PDN). It was found in a small research plot where hemp seeds were planted. The disease described here occurred in a commercial field during the middle of the growth term, affecting a large number of plants. The disease appears to be more aggressive on crown and stem tissue, even though root rot was noticed on some plants. The disease was prevalent when plants were grown under plastic mulch film. Removal of mulch and reduction of soil moisture appeared to reduce the incidence of disease temporarily, but it did not stop the disease development in plants that had been infected
Quantitative vs Qualitative Hop Latent Viroid Testing
www.medicinalgenomics.com/quantitative-vs-qualitative-hlvd-testing/
There are currently no viable treatment options available for Hop Latent Viroid (HLVd) infected cannabis plants. Meristem tissue culture can be used to rescue infected plants, but the process can take up to 3-9 months and doesn’t always result in viroid-free plants. The success rate of tissue culture remediation is often cultivar-specific. Cultivators will surely put in the time and effort to save valuable heirloom cultivars, but many others will scrap infected plants and start a new phenohunt to replace them.
Prevention is surely the best way to protect your operation. There are a number of HLVd testing kits available that cultivators can use to confirm suspected infection or identify asymptomatic plants. Screening mother plants regularly, especially before taking a round of cuttings, would help to ensure only clean plants make it into production. Cultivators should also use extreme caution when introducing new genetics from another facility. New clones should be quarantined and screened for HLVd and other pathogens before they are allowed to share a space with existing plants.
A Case for Using qPCR for HLVd Testing
Medicinal Genomics was the first company to bring Eiken Chemical Co, Ltd.’s patented Loop-Mediated Isothermal Amplification (LAMP)-based testing to the Cannabis field with our youPCR® Gender and THC/CBD testing. We learned a lot from this endeavor and have a few thoughts to share as to why we have not yet deployed this patented technology to Hop Latent Viroid (HLVd) testing out of the gate.
Find Pdf
Quorum quenching is an antivirulence strategy employed by endophytic bacteria
Parijat Kusari & Souvik Kusari & Marc Lamshöft & Selahaddin Sezgin & Michael Spiteller & Oliver Kayser
Appl Microbiol Biotechnol
DOI 10.1007/s00253-014-5807-3
Bacteria predominantly use quorum sensing to regulate a plethora of physiological activities such as cell-cell crosstalk, mutualism, virulence, competence, biofilm formation, and antibiotic resistance. In this study, we investigated how certain potent endophytic bacteria harbored in Cannabis sativa L. plants use quorum quenching as an antivirulence strategy to disrupt the cell-to-cell quorum sensing signals in the biosensor strain, Chromobacterium violaceum. We used a combination of high-performance liquid chromatography high-resolution mass spectrometry (HPLC-ESI-HRMSn ) and matrix-assisted laser desorption ionization imaging highresolution mass spectrometry (MALDI-imaging-HRMS) to first quantify and visualize the spatial distribution of the quorum sensing molecules in the biosensor strain, C. violaceum. We then showed, both quantitatively and visually in high spatial resolution, how selected endophytic bacteria of C. sativa can selectively and differentially quench the quorum sensing molecules of C. violaceum. This study provides fundamental insights into the antivirulence strategies used by endophytes in order to survive in their ecological niches. Such defense mechanisms are evolved in order to thwart the plethora of pathogens invading associated host plants in a manner that prevents the pathogens from developing resistance against the plant/endophyte bioactive secondary metabolites. This work also provides evidence towards utilizing endophytes as tools for biological control of bacterial phytopathogens. In continuation, such insights would even afford new concepts and strategies in the future for combating drug resistant bacteria by quorum-inhibiting clinical therapies.
Not Cannabis Specific
Reducing Botrytis in greenhouse crops: periodic UV-light treatment in tomato plants
Dr. E. Heuvelink
Wageningen, 26 October 2006
Greenhouse growers in The Netherlands, and indeed throughout Europe, face a dilemma in the control of pathogenic fungi on their crops. Their customers demand a product that is free of fungi, while on the other hand, their customers demand a minimal level of pesticide residue (MLR) on the final product, thus severely limiting the options available to the grower in controlling the fungus. In this light, various systems are being developed in Wageningen to assist the growers in controlling fungal growth with minimal or no use of fungicides. One such method is the use of low dosage ultraviolet light. This patented method, owned by Clean Light BV of The Netherlands (PO Box 271, 6700 AG Wageningen, www.cleanlight.nl ), is based on the principle that both fungi and green plants are sensitive to ultraviolet light, but that there is a vast difference in lethal dose between fungi and green plants: Fungi can be killed with a very low dose, while green plants can tolerate much higher doses of ultraviolet light without showing signs of stress. This stands to reason given the observation that green plants survive, and indeed thrive, in full sunlight, while most fungi species only survive in surroundings that are sheltered from direct sunlight. The method then, is based on supplying a dose of ultraviolet light to the fungus that is a) high enough to kill the fungus, while b) low enough, so as not to harm the plant.
Research on crop protection is a very important topic, at the moment
https://www.mmjdaily.com/article/914...at-the-moment/
Crop protection for medical cannabis production in greenhouses or outdoors is a very important topic at the present time. Regulations around the world prohibit the use of chemical crop protections and the search for alternatives to combat diseases and pests is an important one within cannabis operations. Cameron Scott, a graduate student completing a Master’s degree at Simon
Fraser University in Burnaby, B.C. has been focusing on plant diseases that specifically affect the cannabis plant. “If one wants to grow medical cannabis, there are many insect and disease challenges to produce an acceptable crop. That is why research on crop protection is a very important topic at the moment: growers need to be provided with effective solutions that prevent yield loss and protect their crop from being damaged to produce a high quality product for consumers”.
Researchers Identify the Root Pathogens Affecting Hydroponically Grown Cannabis Plants
https://www.analyticalcannabis.com/a...-plants-311240
Dr. Zamir Punja and his research team at the Simon Fraser University in British Columbia have recently published the full results of their three-year-long study into root diseases affecting hydroponically grown cannabis plants.
By sampling plants that exhibited symptoms of root disease - such as stunted growth, brown root lesions, root rot, and leaf discoloration due to minor chlorosis - the research group was able to isolate and identify two genera of pathogens that had infected the plants.
The pathogens from the diseased plants were identified by plating affected root samples on a suitable agar-based medium and letting the fungal cultures develop. These were then broadly identified as being from the Fusarium genus and the Pythium genus and sent to the Agriculture and Food Laboratory in the University of Guelph Laboratory Services for polymerase chain reaction (PCR) analysis, in order to identify the exact species of each fungus that was present. The PCR testing indicated the presence of two species of Pythium (P. dissotocum and P. myriotylum) and two species of Fusarium (F. oxysporum and F. solani). At the tail-end of the study, isolates of Pythium aphanidermatum were also observed in a sub-sample of the diseased root cuttings.
Pythium is a parasitic root fungus which most commonly affects young plants or seedlings. Most Fusarium fungi are actually harmless soil microbes, however, the two species identified here have been known to cause root rot and wilting in plants. Both the Pythium and Fusarium species observed here have been detected in other crops, so it can be concluded that these root pathogens are not uniquely adapted to cannabis.
Root and crown rot pathogens causing wilt symptoms on field-grown marijuana (Cannabis sativa L.) plants
Zamir K. Punja, Cameron Scott & Sarah Chen
Canadian Journal of Plant Pathology Volume 40, 2018 - Issue 4
DOI: 10.1080/07060661.2018.1535470
Yellowing and wilting symptoms on field-grown Cannabis sativa (cannabis) plants followed by total plant collapse under conditions of extreme hot weather were observed in northern California in 2017. The crown regions of affected plants were dark and sunken and internal tissue discolouration extended 10–15 cm above the soil surface. Isolations made from the pith, vascular and cortical tissues in the crown region yielded Fusarium oxysporum (40% frequency), F. brachygibbosum (28% frequency), Pythium aphanidermatum (22% frequency),Fusarium solani and F. equiseti (5% frequency each). Pathogenicity tests were conducted on rooted plantlets to establish the extent of root and crown decay, as well as on mature stems to determine the extent of stem tissue colonization caused by these species. Extensive reduction in root length was caused by F. solani, F. oxysporum, F. brachygibbosum and P. aphanidermatum and wounding significantly enhanced disease development. Stem tissue colonization by these pathogens at wound sites was similarly extensive. Isolates of F. equisetiwere non-pathogenic. Both F. solani and P. aphanidermatum caused plant mortality within 6–10 weeks following inoculation. In phylogenetic analyses using the internal transcribed spacer (ITS) rDNA region and the elongation factor 1 (EF-1?) region, F. oxysporum isolates from cannabis plants in northern California were grouped separately from all other formae speciales and from isolates previously recovered from British Columbia. Two isolates of F. brachygibbosum were identical to an isolate previously reported to infect almond stems in cold storage and field-grown seedlings in northern California. These findings indicate that a complex of pathogens potentially can cause root and crown rot under field conditions, resulting in wilt symptoms and collapse of cannabis plants.
Sequence resource of bacterial communities associated to hemp in Ohio.
Willman, M., Keener, H. M., & Benitez Ponce, M.-S.
Phytobiomes Journal.(2020).
doi:10.1094/pbiomes-09-20-0062-a
In spite of changes in regulation, and increased hemp cultivation and commercialization, information on hemp best production practices in the US is scarce. Due to hemp’s human consumption, particularly as concentrated oil, hemp is often grown with low synthetic chemical
inputs. Therefore, microbiome management and the use of microbial inoculants are important tools to increase hemp productivity. As a first step to characterize the hemp core microbiome, we completed a survey of bacterial communities, associated with different tissue types of plants
grown in a field in Ohio. This local dataset could be integrated with further hemp microbiome surveys to identify potential beneficial interactions relevant to plant health and productivity, but also to evaluate microbiome impacts on product efficacy and safety.
Not Cannabis Specific
Silencing of CrNPR1 and CrNPR3 Alters Plant Susceptibility to Periwinkle Leaf Yellowing Phytoplasma.
Sung, Y.-C., Lin, C.-P., Hsu, H.-J., Chen, Y.-L., & Chen, J.-C.
Frontiers in Plant Science, 10. (2019).
doi:10.3389/fpls.2019.01183
Phytoplasmas are prokaryotic plant pathogens that cause considerable loss in many economically important crops, and an increasing number of phytoplasma diseases are being reported on new hosts. Knowledge of plant defense mechanisms against such pathogens should help to improve strategies for controlling these diseases. Salicylic acid (SA)-mediated defense may play an important role in defense against phytoplasmas. Here, we report that SA accumulated in Madagascar periwinkle (Catharanthus roseus) infected with periwinkle leaf yellowing (PLY) phytoplasma. CrPR1a expression was induced in both symptomatic and non-symptomatic tissues of plants exhibiting PLY. NPR1 plays a central role in SA signaling, and two NPR1 homologs, CrNPR1 and CrNPR3, were identified from a periwinkle transcriptome database. Similar to CrPR1a, CrNPR1 expression was also induced in both symptomatic and non-symptomatic tissues of plants exhibiting PLY. Silencing of CrNPR1, but not CrNPR3, significantly repressed CrPR1a induction in Tobacco rattle virus-infected periwinkle plants. In addition, symptoms of PLY progressed fastest in CrNPR1-silenced plants and slowest in CrNPR3-silenced plants. Consistently, expression of CrNPR1, but not CrNPR3, was induced by phytoplasma infection as well as SA treatment. This study highlights the importance of NPR1- and SA-mediated defense against phytoplasma in periwinkle and offers insight into plant-phytoplasma interactions to improve disease control strategies.
Southern Blight of Hemp caused by Athelia rolfsii detected in Virginia.
Mersha, Z., Kering, M., & Ren, S.
Plant Disease. (2019).
doi:10.1094/pdis-10-19-2178-pdn
Hemp (Cannabis sativa L.) is an annual herb from Cannabaceae family grown for its multitude of uses including fiber, seed and/or oil, and for its medicinal benefits. In August 2019, a hemp farm was visited in Dinwiddie County, Virginia. At one of the locations where the CBD variety ‘Boax’ plants were grown in drip irrigated and plastic mulch covered raised beds, three suspect plants with intermittent but conspicuous yellowing of foliage were clearly discernible. Disease incidence during the time of the visit, including the few symptomatic plants which were already removed after succumbing to the disease, was estimated between 0.5 to 2.0%. Brown to dark lesions, covered for most part by a white fluffy and, at times, by a fan-shaped mycelium that extended from the lower stem to the crown area near the soil-line were visible upon opening up the canopy. The lesions were irregular shaped and extended along the stem perimeter with lesion length ranging between 5 to 62 mm (mean = 24.4 mm). Brownish mustard-seed-like sclerotia of 0.4 to 1.6 mm in diameter (mean = 0.8, n = 34) were seen on the white fluffy mycelium at the soil-line. A sclerotium was aseptically placed at the center of acidified potato dextrose agar (APDA) and incubated at 30°C in the dark. Within 96 h, the white mycelia of the fungus was observed to have clamp connections and completely covered the 85 mm diamter Petri dishes. Slightly bigger sized sclerotia of 1.2 to 4.2 mm in diameter (mean = 2.2, n = 30) were formed 7 days later.
Storage of cannabinoids by Arctia caja and Zonocerus elegans fed on chemically distinct strains of Cannabis sativa.
ROTHSCHILD, M., ROWAN, M. G., & FAIRBAIRN, J. W.
Nature, 266(5603), 650–651. (1977).
doi:10.1038/266650a0
The larva of the warningly coloured tiger moth Arctia caja (L.) (Lepidoptera) and the grasshopper Zonocerus elegans (Thunberg) (Acridoidea) are polyphagous feeders with a predilection for poisonous foods plants. These species can sequester a store various secondary plant substances such as cardiac glycosides and pyrrolizidine alkaloids which presumably function as predator deterrents. We report here that cannabinoids are also stored by both insects. There is good evidence that Cannabis sativa contains at least two chemical races or strains, one rich in the psychoactive substance delta-1-Tetrahydrocannabinol (THC) and the other in the inactive cannabidiol (CBD) and accordingly one of each type was used in our work.
Striatura Ulcerosa
John McPartland, Karl Hillig
June 2004Journal of Industrial Hemp 9(1):89-96
DOI: 10.1300/J237v09n01_10
This is the second in a series of “Cannabis clinic” notes, presenting diseases and pests of hemp, featuring colour illustrations of signs and symptoms. This note concerns Striatura Ulcerosa, the name of a hemp disease caused by the bacterium Pseudomonas syringae pv. mori. The disease was first described in Italy over 100 years ago, but may have originated in China. Greenhouse studies demonstrated that all cultivars of Cannabis are susceptible. Signs and symptoms, life history of the pathogen, and control measures are discussed.
Surveying for Potential Diseases and Abiotic Disorders of Industrial Hemp (Cannabis sativa) Production
Lindsey D. Thiessen, Tyler Schappe, Sarah Cochran, Kristin Hicks, and Angela R. Post
Plant Health Progress 14 Oct 2020
DOI: 10.1094/PHP-03-20-0017-RS
ndustrial hemp (Cannabis sativa L.) has recently been reintroduced as an agricultural commodity in the United States, and, through state-led pilot programs, growers and researchers have been investigating production strategies. Diseases and disorders of industrial hemp in the United States are largely unknowns because record-keeping and taxonomy have improved dramatically in the last several decades. In 2016, North Carolina launched a pilot program to investigate industrial hemp, and diseases and abiotic disorders were surveyed in 2017 and 2018. Producers, consultants, and agricultural extension agents submitted samples to the North Carolina Department of Agriculture and Consumer Services Agronomic Services Division (n = 572) and the North Carolina Plant Disease and Insect Clinic (n = 117). Common field diseases found included Fusarium foliar and flower blights (Fusarium graminearum), Fusarium wilt (Fusarium oxysporum), and Helminthosporium leaf spot (Exserohilum rostratum). Greenhouse diseases were primarily caused by Pythium spp. and Botrytis cinerea. Common environmental disorders were attributed to excessive rainfall flooding roots and poor root development of transplanted clones.
The diverse mycoflora present on dried cannabis (Cannabis sativa L., marijuana) inflorescences in commercial production.
Punja, Z. K.
Canadian Journal of Plant Pathology, 1–13.(2020).
doi:10.1080/07060661.2020.1758959
The objective of this study was to assess harvested dried inflorescences (buds) of cannabis (Cannabis sativa L., marijuana) for fungal presence and diversity. Samples from drying rooms of three licenced facilities in British Columbia were tested repeatedly during 2017–2019. A swab method was used, wherein sterile cotton swabs were gently swabbed over bud surfaces and directly streaked onto potato dextrose agar containing 140 mg L?1 streptomycin sulphate. Petri dishes were incubated at 21–24°C for 5–6 days and the fungal colonies that developed were recorded. The testing was repeated to provide >40 cumulative sampling times over a 2-year period. Representative colonies of each unique morphological type were identified to genus and species by PCR of the ITS1-5.8-ITS2 region of rDNA and sequence analysis. Among 34 different fungal species identified, the most prevalent were Penicillium (comprising 17 different species), followed by species of Cladosporium, Botrytis, Aspergillus, Fusarium, Talaromyces and Alternaria. All samples had several fungal species present and the number and composition varied at different sampling times and within different facilities. The swab method provided a qualitative assessment of viable mould contaminants on cannabis buds and reflected the diversity of mycoflora present, many of which are previously unreported. Fungi on cannabis buds may originate from spores released from diseased or decomposing plant materials, from growing substrates used in cannabis production, or as airborne contaminants in post-harvest trimming and drying rooms. Samples of dried buds exposed to electrobeam (e-beam) radiation treatment had no detectable fungal contamination when assessed using the swab method.
Not Cannabis specific
The Effect of Blue-light-emitting Diodes on Antioxidant Properties and Resistance to Botrytis cinerea in Tomato
Kangmin Kim, Hee-Sun Kook, Ye-Jin Jang, Wang-Hyu Lee, Seralathan Kamala-Kannan, Jong-Chan Chae and Kui-Jae Lee
J Plant Pathol Microb 4: 203.
doi:10.4172/2157- 7471.1000203
In higher plants, blue-light is mainly perceived by cryptochromes and phototropins, which subsequently orchestrates phototropism, chloroplast relocation, stomatal opening, rapid inhibition of hypocotyl elongation and leaf expansion. Blue-light signaling is also known to mediate the plant responses to biotic stresses, but relevant mechanisms are largely unknown. Here, we demonstrated that blue LED (Light Emitting Diode)-driven inhibition of gray mold disease was highly correlated with the increases in cellular protectants like proline, antioxidants and ROS (Reactive Oxygen Species) scavenger activities. After twenty one days of exposure to various wavelengths of LED lights, blue-LED treated tomato displayed significant increases in proline accumulation in the leaves and stems, whereas red- and green-LED treated tomato exhibited the lower proline contents. Similarly, the blue-LED treatment increased the amount of polyphenolic compounds in tomatoes, compared to other wavelength of LED lights. The activities of various ROS (Reactive Oxygen Species) scavenging enzymes were also slightly increased under the blue-LED lighted conditions. Finally, blue-LED significantly suppressed symptom development of tomato infected by gray mold. Combined results suggest that blue LED light inhibits the development of gray mold disease, which can be mechanistically explained by the enhanced proline accumulation and antioxidative processes at least in partial.
NOT CANNABIS SPECIFIC but this virus is found in Cannabis
The elimination of viruses and Hop Latent Viroid from hop (Humulus lupulus L.) in Poland
M. Grudziska, E. Solarska
February 2005Acta horticulturae 668(668):149-152
DOI: 10.17660/ActaHortic.2005.668.19
Hops in Poland are commonly infected with Hop latent viroid (HLVd) and viruses: Prunus necrotic ringspot virus (PNRSV) and Hop mosaic virus (HpMV). Previous experiments were successful in obtaining virus-free hop plants by heat therapy method but appeared to be inefficient for HLVd elimination. In these studies virus and viroid free hop plants were obtained by meristem-tip culture. The meristem tips were excised from lateral shoot tips of naturally infected plants and placed in vitro. In vitro regeneration ability varied between 0 and 46% of regenerated explants depending upon cultivar, depending upon the time at which meristems tips were obtained. The regenerated plants were tested by ELISA for the presence of viruses and by RT-PCR for the presence of HLVd. Plants with no detectable viruses and HLVd were used for further propagation.
Not Cannabis Specific, but found in Cannabis
The experimental transmission of hop latent viroid and its elimination by low temperature treatment and meristem culture
A N ADAMS, D J BARBARA, A MORTON and P DARBYAnnals of Applied Biology 128(1):37 - 44
DOI: 10.1111/j.1744-7348.1996.tb07087.x
Two aspects of hop latent viroid (HLVd) relevant to control were examined:
the production of viroid-free plants from infected material and transmission of HLVd in the field. Plants free from HLVd were obtained by a combination of storing infected source plants at low temperature (2-4°C in the dark) for several months followed by meristem culture using small explants. A total of 77 plants of six cultivars and male pollinator clones were grown from meristems and 28 of these were free from HLVd. Tests showed that the cutting of stems (mimicking the use of tools) was more effective than abrasion (mimicking natural plant to plant contact) for the mechanical transmission of HLVd between hop plants. When field-grown test plants were inoculated, infection occurred more commonly in May before plants had grown large enough for significant contact between neighbouring plants than later in the season. The aphid Phorodon humuli could not be shown to transmit HLVd.
These results indicate that all hop varieties and pollinator clones can be made available to the industry free from HLVd and that the chances of infection can be reduced by avoiding early-season cultural operations that cut into hop shoots.
The Hemp Russet Mite
John McPartland, Karl Hillig
March 2003 Journal of Industrial Hemp 8(2):107-112
DOI: 10.1300/J237v08n02_10
The hemp russet mite Aculops cannabicola (Farkas) is a little-known but potentially dreadful pest. It primarily feeds on leaves, petioles, and meristems. The mites quickly spread between plants grown in proximity. They cause a curling of leaf edges, followed by leaf russeting. The mites feed on the inflorescences of both sexes, and on glandular trichomes, severely reducing resin production. The hemp russet mite constitutes a real menace to world hemp cultivation, because it cannot be controlled easily.
The hemp russet mite Aculops cannabicola (FARKAS, 1960) (ACARI: ERIOPHYOIDEA) FOUND ON CANNABIS SATIVA L. IN SERBIA: SUPPLEMENT TO THE DESCRIPTION
RADMILA PETANOVI, BILJANA MAGUD, and DRAGICA SMILJANI?
Arch. Biol. Sci., Belgrade, 59 (1), 81-85, 2007.
DOI: 10.2298/ABS0701081P
The description of Aculops cannabicola (Farkas, 1960), a new species for the fauna of Serbia, is supplemented. The male and juveniles are described for the first time. This species was found as vagrants on leaves of hemp, Cannabis sativa L. A comparison of characters of the population from Serbia and the originally described samples from Hungary is given.
The Impact of Insect Herbivory in the Level of Cannabinoids in CBD Hemp Varieties
Brandon Jackson, Lenneisha Gilbert, Tigist Tolosa, Shellyann Henry, Victoria Volkis, Simon Zebelo
DOI: 10.21203/rs.3.rs-155271/v1
https://www.researchgate.net/publica...Hemp_Varieties
Background
In the United States, industrial hemp is dened as a Cannabis sativa L. plant not containing more than 0.3% delta-9-tetrahydrocannabinol (D9THC) by dry weight. Plants respond to insect herbivore damage by
changing their chemistry to counter the effects of herbivore attack. Here, we hypothesized that the corn earworm (Helicoverpa zea) infestation might impact the level of cannabinoids (Cannabidiol (CBD) and D9THC).
Results
In a laboratory trial, the CBD hemp, Cherry Blossom, and The Wife varieties were subjected to herbivore damage (HD), Mechanical damage (MD), and Control. After 24hrs of the treatments, we found a significant increase in CBD and D9THC in HD plants compared with MD and Control plants. Similar experiments were conducted in the field condition. A substantial increase in CBD and D9THC observed in herbivore damaged hemp plants compared to the control plants. However, in the field trial, the levels of cannabinoids were not significantly higher in The wife variety. Interestingly, the Corn earworm larvae fed with CBD and D9THC spiked diet showed a significant reduction in body mass, as compared to the larvae fed with the control diets.
Conclusions
The level of cannabinoids seems not genetically xed somewhat; it is affected by insect herbivory. Our results suggest that CBD hemp plants are exposed to insect herbivory spikes in cannabinoid production and surpass the 0.3 % legal limit of D9THC. The growth and development of Corn earworm, the number one hemp pest in North America affected by cannabinoids. The increased concentration of CBD and D9THC observed in herbivore damaged hemp plants might be associated with the direct deterrence of the corn earworm larvae. Further research underway using different hemp varieties to assess if herbivory and other biotic stressors impact the level of cannabinoids.
NOT CANNABIS SPECIFIC but this virus us found in Cannabis
The molecular structure of hop latent viroid (HLV), a new viroid occurring worldwide in hops.
Puchta H1, Ramm K, Sänger HL.
Nucleic Acids Res. 1988 May 25;16(10):4197-216.
DOI: 10.1093/nar/16.10.4197
A new viroid which does not seem to produce any symptoms of disease, and is therefore tentatively named hop latent viroid (HLV) was found to occur worldwide in hops. HLV proved to be infectious when mechanically inoculated onto viroid- and virus-free hops. The viroid nature of HLV was also substantiated by sequence analysis which revealed that HLV is a circular RNA consisting of 256 nucleotides, that can be arranged into the viroid-specific, rod-like secondary structure. HLV also contains the central conserved region typical for most of the presently known viroids. However HLV does not contain the viroid-specific oligo(A) stretch in the upper left part of its rod-like molecule. Because of this feature and a sequence similarity with the prototypes of the other viroid groups below 55%, HLV can be regarded as the first member of a new viroid group.
The occurrence of Hop latent viroid causing disease in Cannabis sativa in California.
Jeremy Warren, Jennifer Mercado, Dan Grace (Dark Heart Nusery report)
Plant Disease
doi.org/10.1094/PDIS-03-19-0530-PDN
https://www.researchgate.net/publica...ldwide_in_hops
In 2017 disease symptoms were noticed on multiple cultivars of Cannabis sativa plants grown in California, including; stunting, malformation or chlorosis of leaves, brittle stems and reduction in yields. Additionally, cuttings taken from symptomatic plants for clonal propagation showed a reduced rooting success rate. Leaf tissues from five symptomatic and five asymptomatic plants were selected for RNA isolation and subsequent sequencing from northern California (37.7567466, -122.1930517). Total RNA was isolated from leaf tissue using TRIzol reagent (Thermo Fisher). Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit, Plant (Illumina). RNA-seq libraries were synthesized using YourSeq RNA-seq kit for full transcript coverage libraries (Amaryllis Nucleics, Oakland California). Libraries were sequenced on an Illumina NextSeq 500 using single-read 80bp (Amaryllis Nucleics). Each sample resulted in between 12,861,714 and 19,376,549 reads (data available at www.mg-rast.org project HpLVd – Can). The resulting sequences were de novo assembled and the resulting contigs were aligned to the Cannabis sativa draft genome (ASM341772v2). Contigs that matched the Cannabis sativa genome were removed from the analysis and the remaining contigs were compared to sequences in the viral and viroid Genbank databases. All five symptomatic plants had a single 256 nucleotide contig (total reads mapped per contig: ranged from 4,162 to 50,095) that matched Hop latent viroid (HLVd).
The Occurrence of Hop Latent Viroid in Cannabis sativa with symptoms of Cannabis Stunting Disease in California
Ali Bektas, Kayla M. Hardwick, Kristen Waterman, Jessica Kristof
June 2019 Plant Disease
DOI: 10.1094/PDIS-03-19-0459-PDN
In February 2018 we sampled three symptomatic and three asymptomatic Cannabis plants suspected to host a viral agent from a farm in Santa Barbara County, CA. The symptoms included brittle stems, an outwardly horizontal plant structure and reduced flower mass and trichomes. RNA from each flower sample was extracted using a QIAmp Viral Mini Kit (Qiagen, Hilden, Germany). RNA was purified, concentrated, and ribo-depleted before library construction with NEBNext Ultra II Directional RNA kit (NEB, Ipswich, MA). Individual libraries were tagged with unique adapters and pooled for sequencing with a NextSeq High Output 300 cycle kit (Illumina, San Diego, CA). Sequence data were assembled with Trinity (Grabherr et al. 2011), and Blobtools (Laetsch and Blaxter 2017) was used to search for viral sequences. Possible viral transcripts were filtered for at least 10× coverage, 95% BLAST identity, and alignment length greater than 80% of query and subject sequences. One hundred twenty-five transcripts showed significant similarity to hop latent viroid (HLVd) sequence EF613183. We used STAR (Dobin et al. 2013) to align reads to the transcripts and found that 2.4% of read pairs from symptomatic libraries (of a total of 153,001,495 read pairs) and 0.0001% of read pairs from asymptomatic libraries (of a total of 159,608,791 read pairs) mapped to the putative HLVd sequences. We also identified a transcript with high homology to C. sativa mitovirus 1 (BK010428). Reads from all libraries mapped to this transcript in similar numbers; thus, the mitovirus is unlikely to be associated with the disease symptoms. To confirm our findings, we used two HLVd-specific primer pairs in reverse transcription PCR (RT-PCR). The Zeigler et al. (2014) primer pair produced the expected HLVd amplicon size from only the symptomatic plants, whereas the primer pair of Eastwell and Nelson (2007) produced the expected HLVd amplification pattern from all samples collected. The amplicons were Sanger sequenced and produced at least 200 bp of data with 95% or more pairwise identity to HLVd sequences in GenBank. One sample, CV1 (MK791751), produced 98% pairwise identity across the whole 256-bp HLVd genome as published by Puchta et al. (AX07397). In February 2019, we sampled seven symptomatic and three asymptomatic plants from another farm in Alameda County, CA. RT-PCR revealed the presence of HLVd in all symptomatic plants and one asymptomatic plant. Amplicons from four of these samples were Sanger sequenced and confirmed to be HLVd (MK791747 to MK791750). Analysis of the sequences obtained from the two locations revealed two single-nucleotide polymorphisms between them at positions 190 and 225, which include the centrally conserved region (Puchta et al. 1988). The consistent detection of HLVd alone in all symptomatic plants from both locations and its occurrence in only a few asymptomatic plants point to an association of the disease with the stunted Cannabis. HLVd can persist in hops without symptoms, and Cannabis cultivators should take measures to minimize mechanical transmission while keeping in mind that HLVd may also be seed transmissible (Pethybridge et al. 2008). Considering the detrimental effects of HLVd to the commercially valuable secondary metabolites of the species, a thorough investigation of susceptibility as well as range and expression of Cannabis stunting disease should be conducted at this important juncture.
NOT CANNABIS SPECIFIC
The specific host plant DNA detection suggests a potential migration of Apolygus lucorum from cotton to mungbean fields
Qian Wang1, Wei-Fang Bao, Fan Yang, Bin Xu1, Yi-Zhong Yang
PLoS ONE 12(6): e0177789.
Doi: 10.1371/journal.pone.0177789
The polyphagous mirid bug Apolygus lucorum (Heteroptera: Miridae) has more than 200 species of host plants and is an insect pest of important agricultural crops, including cotton (Gossypium hirsutum) and mungbean (Vigna radiata). Previous field trials have shown that A. lucorum adults prefer mungbean to cotton plants, indicating the considerable potential of mungbean as a trap crop in cotton fields. However, direct evidence supporting the migration of A. lucorum adults from cotton to mungbean is lacking. We developed a DNA-based polymerase chain reaction (PCR) approach to reveal the movement of A. lucorum between neighboring mungbean and cotton fields. Two pairs of PCR primers specific to cotton or mungbean were designed to target the trnL-trnF region of chloroplast DNA. Significant differences in the detectability half-life (DS50) were observed between these two host plants, and the mean for cotton (8.26 h) was approximately two times longer than that of mungbean (4.38 h), requiring weighted mean calculations to compare the detectability of plant DNA in the guts of field-collected bugs. In field trials, cotton DNA was detected in the guts of the adult A. lucorum individuals collected in mungbean plots, and the cotton DNA detection rate decreased successively from 5 to 15 m away from the mungbean-cotton midline. In addition to the specific detection of cotton- and mungbean-fed bugs, both cotton and mungbean DNA were simultaneously detected within the guts of single individuals caught from mungbean fields. This study successfully established a tool for molecular gut-content analyses and clearly demonstrated the movement of A. lucorum adults from cotton to neighboring mungbean fields, providing new insights into understanding the feeding characteristics and landscape-level ecology of A. lucorum under natural conditions.
The Threat of Viral Cannabis Diseases
Robert Clarke
Cannabis Business Times Aug. 2020 pg 44-48
https://www.cannabisbusinesstimes.c...ns-the-threat-of-viral-cannabis-diseases-cds/
Around the world people are coming to grips with the health issues and economic fallout of COVID-19. Public awareness of viral contagions is reaching unprecedented levels, presenting an opportune moment to address disease problems within the cannabis industry. As we are seeing with health issues and economic fallout of COVID-19. Public awareness of viral contagions is reaching unprecedented levels, presenting an opportune moment to address disease problems within the cannabis industry. As we are seeing with the novel coronavirus pandemic, harmful viruses emerge and adapt, and this is not exclusive to humans. Cannabisgrowers are increasingly experiencing the negative economic outcomes of decreased vigor, lower flower yields and reduced production of primary target compounds including both cannabinoids and terpenoids. What we are calling “Cannabisdisease syndrome” exhibits a suite of consistent symptoms, but with no readily apparent single cause. These symptoms, which do not appear to be caused by nutrient deficiencies or other pathogens, are often collectively referred to as “dudding” or “dudders.” (The term originated when growers would think a plant with decreased vigor or stunted growth was “just a dud.”)
Steadily declining vigor in commercial Cannabisclones is not a new phenomenon. As vegetative reproduction by rooting cuttings became popular in the 1980s, growers would occasionally see a clone that became weaker and less productive each time cuttings were flowered. Apart from lowered yield, there were few other symptoms of infection. We tentatively called this a “photocopy effect” based on our analogy that copying a copy of a copy of a copy, results in a faded image that eventually becomes a mere ghost of the original. We knew that because lost vigor was appearing in asexuallymultiplied serial cuttings the problem could not be explained by “genetic drift,” which is a shift in the frequency of genes within a small sexuallyreproducing population. Growers wondered what the causes might be, and even addressed the possibility that simply making serial cuttings might result in diminished vigor. Soon we realized the symptoms were caused by transmission of an infectious disease that became more and more prevalent through successive rounds of multiplication. (More on this later.) We destroyed clones exhibiting symptoms, carefully sterilized benches, pots and tools, and began to use fresh blades when taking cuttings from each mother plant. There were no known causes, just obvious adverse effects. Yet we found practical solutions, and soon the problem nearly disappeared. Some similarities exist between the Cannabis disease syndrome (CDS) we are experiencing today and COVID-19. Much like the human coronavirus, CDS is difficult to detect at first, as there. is a wide range of symptoms. Through our and other growers’ observations of affected plants during the past few years, we have learned that vegetative plants can transmit CDS, while flowering plants are more likely to suffer the consequences. Because symptoms are not readily visible and are easily confused with other diseases, they both lie hidden within populations, and can very quickly become economically impactful. Another similarity between CDS and COVID-19 is that asymptomatic plants can infect the otherwise healthy, with more serious outcomes for some than others. Molecular testing is required to identify potential infections, and there are few laboratories that can effectively identify the causal organisms. Other than practicing social distancing and establishing quarantines, there are as yet no solutions to stopping their spread. Cannabis disease syndrome cannot be attributed to a single pathogen, although there is a primary candidate for its cause (more on this later). In symptomatic plants, several infectious organisms may be involved, making accurate diagnosis and effective control even more difficult. If CDS killed more of its hosts rather than simply making them sick, then it would have been noticed much earlier, and should not have already spread so widely. As we also have observed while studying affected plants, the cannabis disease syndrome spreads most quickly by taking cuttings from infected plants, using them as mother plants, and thereby multiplying the disease through future generations.
The Use of Cannabis sativa L. for Pest Control: From the Ethnobotanical Knowledge to a Systematic Review of Experimental Studies
Genı´s Ona, Manica Balant, Jose´ Carlos Bouso, Airy Gras, Joan Valle`s, Daniel Vitales, and Teresa Garnatje
Cannabis and Cannabinoid Research Volume X, Number X, 2021
DOI: 10.1089/can.2021.0095
https://www.liebertpub.com/doi/abs/1...ournalCode=can
Background: Despite the benefits that synthetic pesticides have provided in terms of pest and disease control, they cause serious long-term consequences for both the environment and living organisms. Interest in ecofriendly products has subsequently increased in recent years.
Methods: This article briefly analyzes the available ethnobotanical evidence regarding the use of Cannabis sativa as a pesticide and offers a systematic review of experimental studies.
Results: Our findings indicate that both ethnobotanical and experimental procedures support the use of C. sativa as a pesticide, as remarkable toxicity has been observed against pest organisms. The results included in the systematic review of experimental studies (n = 30) show a high degree of heterogeneity, but certain conclusions can be extracted to guide further research. For instance, promising pesticide properties were reported for most of the groups of species tested, especially Arachnida and Insecta; the efficacy of C. sativa as a pesticide can be derived from a wide variety of compounds that it contains and possible synergistic effects; it is crucial to standardize the phytochemical profile of C. sativa plants used as well as to obtain easily reproducible results; appropriate extraction methods should be explored; and upper inflorescences of the plant may be preferred for the production of the essential oil, but further studies should explore better other parts of the plant.
Conclusion: In the coming years, as new findings are produced, the promising potential of C. sativa as a pesticide will be elucidated, and reviews such as the present one constitute useful basic tools to make these processes easier.
Find Pdf
(Not Cannabis specific but virus is found in Cannabis)
The Variability of Hop Latent Viroid as Induced upon Heat Treatment.
Matoušek, J., Patzak, J., Orctová, L., Schubert, J., Vrba, L., Steger, G., & Riesner, D.
Virology, 287(2), 349–358. (2001).
doi:10.1006/viro.2001.1044
We have previously shown that heat treatment of hop plants infected by hop latent viroid (HLVd) reduces viroid levels. Here we investigate whether such heat treatment leads to the accumulation of sequence variability in HLVd. We observed a negligible level of mutated variants in HLVd under standard cultivation conditions. In contrast, the heat treatment of hop led to HLVd degradation and, simultaneously, to a significant increase in sequence variations, as judged from temperature gradient–gel electrophoresis analysis and cDNA library screening by DNA heteroduplex analysis. Thirty-one cDNA clones (9.8%) were identified as deviating forms. Sequencing showed mostly the presence of quadruple and triple mutants, suggesting an accumulation of mutations in HLVd during successive replication cycles. Sixty-nine percent of base changes were localised in the left half and 31% in the right half of the secondary structure proposed for this viroid. No mutations were found in the central part of the upper conserved region. A “hot spot” region was identified in a domain known as a “pathogenicity domain” in the group representative, potato spindle tuber viroid. Most mutations are predicted to destabilise HLVd secondary structure. All mutated cDNAs, however, were infectious and evolved into complex progeny populations containing molecular variants maintained at low levels.
Three Botrytis species found causing gray mold on industrial hemp (Cannabis sativa) in Oregon
A.R. Garfinkel
DOI: 10.1094/PDIS-01-20-0055-PDN
In September and October of 2019, flowers of hemp plants in Polk and Linn counties in Oregon showed symptoms of die-back with necrosis of the tissues, resulting in significant yield reductions. The tops of the inflorescences were often the most severely affected with the infection sometimes moving down into the petiole or stem. Up to 90% of the plants in these fields had at least one flower infection present, however, foliar symptoms (lesions) were not observed. Gray to white mycelium and Botrytis-like conidiophores could often be seen arising from host tissue. The fungus was recovered from colonized plant tissues either by placing conidia directly onto a Petri dish containing potato dextrose agar (PDA) or placing a small piece of surface sterilized plant tissue onto PDA. A total of 23 pure cultures were recovered from three fields. All cultures displayed white to gray, fast-growing mycelium within which conidiophores sometimes developed bearing Botryose clusters of conidia, followed by the formation of black sclerotia in all isolates.
Too Many Mouldy Joints – Marijuana aand Chronic Pulmonary Aspergillosis
Yousef Gargani, Paul Bishop and David W. Denning
Mediterr J Hematol Infect Dis 2011, 3; Open Journal System
DOI 10.4084/MJHID.2011.005
Chronic pulmonary aspergillosis is a progressive debilitating disease with multiple underlying pulmonary diseases described. Here we report the association of chronic pulmonary aspergillosis and long term marijuana smoking in 2 patients and review the literature related to invasive and allergic aspergillosis.
Toxic effects of palpoluck Polygonum hydropepper L. and Bhang Cannabis sativa L. plants extracts against termites Heterotermes indicola (Wasmann) and
Coptotermes heimi (Wasmann) (Isoptera: Rhinotermitidae)
Hayat Badshah, Abdus Sattar Khan, Abid Farid, Alam Zeb
and Amanullah Khan
Songklanakarin J. Sci. Technol., 2005, 27(4) : 705-710
https://thaiscience.info/Journals/Ar...G/10986937.pdf
A research project was carried out aimed at to study the toxic effects of Palpoluck Polygonum hydropipper L. and Bhang Cannabis sativa L. crude extracts against two species of termites i.e. Heterotermes indicola (Wasmann) and Coptotermes heimi (Wasmann) at Nuclear institute for Food and Agriculture (NIFA) Peshawar, Pakistan in April 2002. Results revealed that after ten days of feeding maximum percent mortality in case of Polygonum hydropipper L. leaf and flower extracts was 28.0, 52.0, 28 and 74.7 for H. indicola and Coptotermes heimi respectively, while in control only 10.7 and 12.0% mortality were recorded. Similarly, for the same species of termites the percent mortality in Cannabis sativa L. extracts was 54.7, 64.0, 58.7 and 70.7 for leaf and seed extracts respectively, while in control only 12.0 and 10.7% mortality were observed. In each extract mortality was significantly different from that of control. Toxic effects of both extracts (leaf and flower) were more profound against Coptotermes heimi than Heterotermes indicola during these ten days of feeding. Also the seed extracts caused more mortality than the leaves for both species, suggesting the availability of high contents of toxic materials in seed.
Two Aphid Species, Phorodon cannabis and Rhopalosiphum
rufiabdominal, Identified as Potential Pests on Industrial Hemp, L., in the US Midwest
Doris Lagos-Kutz, Bruce Potter, Christina DiFonzo,Glen L. Hartman, Russell A. Howard
January 2018 Project: Suction Trap Network in the Midwest
DOI: 10.2134/cftm2018.04.0032
Cannabis sativa L. is indigenous to eastern Asia, grown since ancient times for its medicinal and textile uses (Russo et al., 2008). In the USA, production is currently increasing (USDA-NRCS, 2018)
for industrial fiber, seed oil, medicinal and recreational uses. As production increases, there is growing interest in properly identifying and managing pests attacking the crop in both field and greenhouse environments. In this brief we provide new records of distribution of Phorodon cannabis, a recently introduced insect species in the USA, and Rhopalosiphum rufiabdominale, a widely distributed species on grasses and other dicots. In addition, we are including morphological and molecular information of P. cannabis and P. humuli to avoidthe misidentification of these two closely related insect species
Using Ultraviolet Light to Stop Gray Mold, Powdery Mildew & Other Marijuana Plagues
Marijuana Growing Educators April 9, 2019
https://growingmarijuanaperfectly.co.. .ana-grow-room/
This is an important update to an article we posted a while ago, about using ultraviolet light to fight gray mold, powdery mildew and similar marijuana enemies. The photo you see just above this text shows you two marijuana leaves–one treated with ultraviolet light, and the other not treated. The untreated leaf is infested with powdery mildew, but an ultraviolet light device made by a company called CleanLight blocked powdery mildew on the other leaf!
Ultraviolet light can kill molds and fungi, which are some of the biggest causes of crop failures in marijuana grow rooms. Obviously, you want to know how to do that same mildew-killing ultraviolet treatment in your marijuana garden. In the original version of this article, we discussed an ultraviolet device called the Reme Halo. The Halo is a tiny device that has to be installed by an HVAC professional inline in your grow op building’s air handler. It uses a low-watt ultraviolet light and an ionized hydroperoxide generator to scrub air. The manufacturer claims it removes mold, fungi, and odor.
Not Cannabis Specific
UV light offers possibilities against powdery mildew
https://cleanlight.nl/wp-content/upl...ery-mildew.pdf
The latest experiments with UV light indicate that fewer fungicide applications are required when applied in the correct manner. DLV (research group) tested the potential of UV light treatments on several nursery crops and perennials.
Western Plant Diagnostic Network News : Pythium aphanidermatum Crown Rot of Industrial Hemp
September 2017
Jennifer Schoener, Shouhua Wang, Rus Wilhelm
https://www.npdn.org/system/files/NPDN_September-17.pdf
Cultivation of industrial hemp (Cannabis sativa) was first approved in 2014 for the purpose of research and development. The Federal Farm Bill Section 7606 authorizes state agencies to conduct pilot trials on the crop to assess crop viability for the creation of an industry in prospective states. In Nevada, the Department of Agriculture authorizes the production of hemp crops for research purposes. The acreage of hemp production in Nevada is relatively small in comparison to the acreage in other states. However, plant diseases associated with hemp crops have been occurring in Nevada in recent years. In 2016, the Nevada Department of Agriculture Plant Pathology Lab detected Fusarium root rot and sudden death disease from an industrial hemp crop, and Fusarium wilt from medical marijuana plants. Here we describe a newly detected hemp disease: Pythium aphanidermatum crown rot.
White Leaf Spot
John McPartland, Karl Hillig
April 2006 Journal of Industrial Hemp 11(1):43-50
DOI: 10.1300/J237v11n01_06
This note continues the “Cannabis Clinic” series, presenting diseases and pests of hemp, featuring color illustrations of signs and symptoms. White leaf spot is caused by a fungus, Phomopsis ganjae.
Signs and symptoms of the disease, life history of the pathogen, differential diagnosis, and control measures are discussed. Disease symptoms and fungus morphology are presented in a series of photographs, each representing approximately one-tenth the scale of the previous photo, to provide an enhanced perspective of scale and proportion
Zur virusanfälligkeit von hanfsorten (Cannabis sativaL.).
Kegler, H., & Spaar, D. (1997).
Archives Of Phytopathology And Plant Protection, 30(5), 457–464.
doi:10.1080/03235409709383198
ON THE VIRUS SUSCEPTIBILITY OF VARIETIES OF CANNABIS SATIVA L. The growing of hemp (Cannabis sativa L.) as a reproducing raw material is increasing in Europe. Investigations concerning the susceptibility of three hemp genotypes to 8 plantpathogenic viruses of various taxonomic groups showed distinct differences
Last edited:
